Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1454
Length(NT) : 734
Best Gene Model Blast : Link to GSTUMT00008722001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein SNOG_04760
Accession: ref|XP_001795172.1| Score: 280 E_value: 8e-29
KEGG Definition: hypothetical protein
Accession: ncr:NCU02737.1 Score: 312 E_value: 2e-27
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG3182 Score: 253 E_value: 8e-23
PFAM Definition: ChaC, ChaC-like protein. The ChaC protein is thought to be associated with the putative ChaA Ca2+/H+ cation transport protein in Escherichia coli. Its function is not known. This family also includes homologues regions from several other bacterial and eukaryotic proteins..
Pfam Number: pfam04752 Score: 220 E_value: 5e-19
Swissprot: Q5SPB6|CHAC1_DANRE

Sequence:
>Contig1454
TTGGAGACTTTCTTCCCCCACCAGCAAGCACGGCGCTTTTCTACACTTCT
ATTTTGTTTCTATTTGCTTCAACTAAGAACACCGAATCCACGTCAGATGA
ACCATTCAACTGAATTCTGGTTGTTCGGATATGGGTAAGGCAACGGAGCT
AATGGAGGGGAAAATTCGCATAGCAAGGGGGAGAATATTGCTCTCATGAT
AGATGCAACTTCCTTCTTGTTGACCCGTTTTTTTTTTTTCTAATACCGAT
CTTCTCGTGATTTAGAAGCCTCATCTGGAAGCCACCGCCAGACTATGATC
GTCGAGTCCCAGGTTACATTAAAGGCAAGCTGTTGGATACTTGTTTGATG
GATATTCTCGGAGATGGAGCTTTTTTCTAACTCCTTTTTTACCATGGCAG
GCTTCGTGAGGAGGTTTTGGCAATCTAGTGAGGACCACCGTGGAACGCCG
GAGGCACCCGGGCGAGTAGTTACATTGATCGAGAGATCATACTGGAAGAC
ACTGAACGATCATGACTTTGAGGACGATGACCAGGTATGGGGTATGGCCT
TCAGGATTAAGGCCAATCGAGTAAAAGACGTAATGAGGGAGTTGAACATT
CGGGAAATAAACGGGTATAGCATCCGGAACGACATCGAGGTGTTTTCGTT
CTCGGCGGACGTCCCGCCAATCAAGGCATTAGTTTATATAGGGACACCCG
GAAACCCGCAATTTGTCGCACGCGAAGGCGTTCC

Sequences in the Contig:

SY0AAA46YI08FM1 SY0AAA50YJ11FM1 SY0AAB58YM06FM1
SY0AAB6YA01FM1 SY0AAC1YG21FM1