Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1453
Length(NT) : 1396
Best Gene Model Blast : Link to GSTUMT00007270001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001543717.1| Score: 561 E_value: 2e-55
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1453
TTGGGTCTTCCTTTCTCCCCCATCCCCAGTTAGAACGACATCATTGACAG
ACCAAGATAGCCAAACATGCCGTCTGCTGATCGTTCCGAATGGCGCAATA
CTTTCATTTACGCTTCCAACAATCGTGATACCGTGCTCGGAGGCCTCTGG
GCCACCCCGGGTATTACAAACCGCAATCTCTATGCCATGCTAGATATTTT
TTGTTTGTTTAGCAACCCTTTCGAGCTACACGACGAGGACGGACGGTTAG
TTGAAATGGATGAGGCACAGCTTCAACCGGGCAATTACTATATTGTTACT
CAGGGTGACGTTATTCTCACTGATGAGGCACCGCTACTTCGTACGATTTC
GTTGCAGTCCGGAACCCGTGTTGCTGCGTTCCGTGATGAAGTACGTGCAC
GAGACGGACGCTGCCTTTTCACCGGCCACCGATCAGGCAGGTGGATAGGC
TTGGAAGCCGCTCACATCTTTCCCCTGGCATACGAGGGGTACTGGAAAGA
TCATAACTACGGCCGTTGGATTACCGTTCCGCCGACAAATCCCTCCCACG
GATCGATCAACTCTGTACAGAATGGGATCTTGCTCGATTCCAGTATGCAC
CACTATTTTGATTCCTATCATTTGACAATTAATCCCGATGATAACTACAA
GATCGTCTCCTTCGCAGAGGAATCCCTTCAATTTAACCTCCCTCACCAAC
TTGATCAGACGTTCCTCCAGAATCCACTCCGACCGGTCGATCAGCTTCTC
CGCTGGCATTTTCGCCAGGCAGTGCTCACGAATATGAAGGGAGTTGGGGA
GCCTTGTTTTGAGAACGATTTCCCGCCTGGCACGGACATGATGGGTGAGA
TCATGAGCGGTCCAAAGGCTGGAGAGAGGATGGAGTTTGAGCTGTTTAGC
CGCTTTAACGCAGCGGGGGGTTCACACGTGGTGAAGTCTACCTAGAGCAC
TACTAGCACAATATTCAATAAAACTGGGTTTACCGGCGGTGTTCGCTCAT
AAATTCACGGGAAACCAAGCGGGCCCGGAGGTGTGATGTTAAACAAGACG
AGCAACCAAAACACTTTGTTCCAAGTACTACCATGGGCGGACCCTCCTCG
CAGCCCTCCTTCCAACAACCACACCAGACAACATCTTGCCTTCAAATGAA
ACGCCATGAGAATTACCATTACCGGAGAACGATACCTGCAGCCTCGTTCT
ACTTTGCTACCCTCGGTACGAGGCCCCACTATAGCCACGGTTATCGACCT
TTCACCTCGGGAGTAAATCGGATAAAGAAGGACGTATCATGGTTTGAGGG
CAAATGGGCCGAATGTTCGGCTGGAGGTGATAGAACGTGTCAAGGCAAAT
GTTCTACTATGAGAAGTGTATAAGGAAGCTGGTTCTTCTCTTTATT

Sequences in the Contig:

SY0AAA50YI20FM1 SY0AAC20YJ11FM1 SY0AAC31YA08FM1
SY0AAC31YA08RM1 SY0AAC38YC07FM1 SY0AAC48YK02FM1
SY0AAD19YO08FM1 SY0AAD23YI17FM1 SY0AAD33YG17FM1