Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1452
Length(NT) : 846
Best Gene Model Blast : Link to GSTUMT00001346001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: predicted protein
Accession: gb|EDR06879.1| Score: 670 E_value: 2e-68
KEGG Definition: hypothetical protein
Accession: ani:AN8955.2 Score: 627 E_value: 9e-64
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG2533 Score: 499 E_value: 3e-51
PFAM Definition: MFS_1, Major Facilitator Superfamily..
Pfam Number: pfam07690 Score: 231 E_value: 4e-20
Swissprot: Q10097|YAOI_SCHPO
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum

Sequence:
>Contig1452
TTGGTAAAGACTCTTGAACCCCGGATAAAGCTCGAAGGGTACCGGTACCA
TATCAGAAGCTTCTTGCTCTCGAGCACAAGCCCTTTTCCTTTCCTTTCCT
TCCACCCCCCGTCCTTCATTCCCCCCCCCCTCTCTCCCCCTTCCAACTAC
TTGTGTCAATTGAGCCTCTGAGAGTTATATTCCGACAATATCAAAAGGAT
GTCAGAAGGAAGTACCATTGAGAAGGAGGCGAAGCATATTGATGGAACTG
TTACCCCGGACTCATTGGAGTCCTCCGACCTGGCCTGCTTCGACGAGAAG
AGAACGAAGAAGCTTCTGAGGAAGTTGGATTGGCATCTCGTGCCCTTTTT
GGCACTACTTTACTTACTTTCATTCCTGGATCGCACAAACATTGGCAATG
CACGCTTGGCTGGGCTTGAGAAGGACCTTGGCATGTCGGGTCTTGACTAC
AATGTTGCCCTCGCAGTATTCTTCCCTTGGTATGTCGCGGCCGAAGTCCC
CAGCAATCTCATGATGAAGAGGACCCGGCCTTCTCTCTGGCTCACCATTA
TCATGGTTGCTTGGGGTATCACCATGACCCTCATGGGTTTGGTCACCAAC
TATGTCGGTCTCTTGATCTGTCGTATGGCTCTCGGTTTAACAGAGGGTGG
TCTATTCCCTGGTGTCACTTTCTACATCACCATGTGGTATAGACGTCACG
AATGCGGTCTCCGTATGGCGATATTCTTCTCTGCTGCTACCCTTGCCGGT
GCCTTCGGTGGTCTCTTGGCCAGAGGTATCTCTGAGATGGCGGGTGTTGG
GGGAAAGCCTGGATGGGCCTGGATTTTCATTCTCGAGGGATTGGTT

Sequences in the Contig:

SY0AAA50YH04FM1 SY0AAA50YI18FM1 SY0AAB27YK20FM1
SY0AAB46YG21FM1