Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1451
Length(NT) : 1579
Best Gene Model Blast : Link to GSTUMT00011141001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein SS1G_02876
Accession: ref|XP_001596654.1| Score: 308 E_value: 4e-26
KEGG Definition: hypothetical protein
Accession: mgr:MGG_00179 Score: 192 E_value: 6e-13
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1451
TTGGGCCACCGCATCACCCTCGCTTAGCAGTGCTCCTGGAAGCGCCAACA
ACTCCCCCACCAAGCGTTCACCGTCCAAGAAGATGCATAAGAAGGCTCTC
AGTGACTCTCCCTTGGCCGCAACCGGATCCTTCTCCGACAATCGTGACAT
TTCTTCTATCGGTGCGAGCGACGAGGTGCCAGCTCCTTCTGAAGAAATGC
CTTCAGAATCGACATATGAGAAGCGGAAGCAGAAGAAGAAGAAGAGTAAG
AAGCAGATCAAGAACTGGGCTGGAACAATTCTGGGTAAGGGTCGTGGGCT
CCGTCACTCGAAGCGGCAACTTAGAGCTCTCCCAAGGAGGTCACCAACGC
CACCACTGCCAAGGCCAGAGCATCAATTGGGTGACAATGAATGGATTTCA
GCTGCGTGGAATGAGAGCTATGTTCTCATGCCGGTTGATGATTCACTAGG
GGCGAACTCCAGCTCGGAGAACATTGCCATGGACACTGGAGTTGAGAGTC
CTATCATTGACTTGGATGCTGCTTTGGGCCCTTTCAAAACTCCCACCGGA
CCTAGTGCTGGCTTTGCCGCTGCTAGGCGGAGAAGAATGCATTCTGCGGT
TGGATTGAAGGGAAATGGGTACTTTCATAGGCGTAGCGAGAGTATGCCGG
AAATGCAACTTTTCTCTCTCTCGGAACATGAGGGTGATGGTCATATGGCC
GATGTGTTCGAGGAGGATGAAGAAGAGGATAGTGAGGAGAGCTCTGAGAG
TGAGGATGATGATGAGGAAGCCAAGATGGACGGTGGAGAGGGTCTTGGAA
TTGGTATCAAGGTTGTTGATGGCGATGGGGCGAACTGGCAGGAGGATGTA
GTGATGGAATGGGGATCTGATGATTTGGGACGTCCAACATCGAGGAGGGG
AAGTGGAGGAGATCGTGATCTGGGCTGGAAGAGTGAGAGCAGTCTACTTT
CAGCCAACACTTCTCTTAACCCGGAGAGCAGCACGACATCAATTAACTCC
ATCAACTGTCCCCAAGACATTGAAGTCGGATCGTCCTCTCCATTAACCCT
TTCGGGCCGCAAGGGCGCGCCAGCGGACATCATCACCCCTCAATCGTCTA
GCTCAACTGTCACACTTCCAGCGCACTTCCAACCACCTACATACCCCCAA
TCCCTCGACTCACCGTCAACCTTCGTCACTGCCGCCTCAAACCCAAATAC
CCCCCTCCAACTCGACTTTCCCGGGGATGAATACCCTGACTCGGCCTCCA
GCTTCGGCCCATACTCAGATTTCCTCGGCGAGCCCGGCCCGGAGATGCGC
ATGAGTGTTGACGATATACCTAGCCTAACCTCCTCATCTAGCACTATGAC
GATTGGGGGACTGTACGCCAATATGCCATCGACACCCATGAACGAGCCTA
AGGAGAAGGAACCATCCCATAAGAAGGAGAAGTCAAAGCGGTGGAGCAAA
GTATGGACCTTCTGGAAGTTGAAGTAAAAAGCGTATTTGACTTGTTTGTT
TATGTCTCTCTATCTTGCTCTGTTTGGCTTTGGTTTAGCTTCATCTAGCT
CTGTCTGTCTGTCCCTTGTTAATGTGTTC

Sequences in the Contig:

SY0AAA21YC22FM1 SY0AAA50YI11FM1 SY0AAA52YJ07FM1
SY0AAB12YP07FM1