Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1450
Length(NT) : 642
Best Gene Model Blast : Link to GSTUMT00003970001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein MGG_03905
Accession: ref|XP_361431.1| Score: 409 E_value: 2e-38
KEGG Definition: hypothetical protein
Accession: mgr:MGG_03905 Score: 409 E_value: 1e-38
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG1638 Score: 259 E_value: 1e-23
PFAM Definition: Steroid_dh, 3-oxo-5-alpha-steroid 4-dehydrogenase. This family consists of 3-oxo-5-alpha-steroid 4-dehydrogenases, EC:1.3.99.5 Also known as Steroid 5-alpha-reductase, the reaction catalysed by this enzyme is: 3-oxo-5-alpha-steroid + acceptor <=> 3-oxo-delta(4)-steroid + reduced acceptor. The Steroid 5-alpha-reductase enzyme is responsible for the formation of dihydrotestosterone, this hormone promotes the differentiation of male external genitalia and the prostate during fetal development. In humans mutations in this enzyme can cause a form of male pseudohermaphorditism in which the external genitalia and prostate fail to develop normally. A related enzyme is also found in plants is DET2, a steroid reductase from Arabidopsis thaliana. Mutations in this enzyme cause defects in light-regulated development..
Pfam Number: pfam02544 Score: 123 E_value: 9e-08
Swissprot: Q9UT20|YFY8_SCHPO
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum

Sequence:
>Contig1450
TTGGAGATGATAGGTTTCCTACGCTCTGGAGGGCTTTTTCCTCTCACTAG
GGATGCGTGGCAACTTCTCTTGAGGTGTTGGAAGTATTTTCCCCTGGTCG
CGCCACTTCAGTTGGCTCTCCCGGAGTTCTATCCTGCCGGAAAAACCTCG
TACCCTTCCATCTTCAACGTACCCGGAAAACCGGGATGGATTTTCATGGA
GCTCTTCTCTCCGCTCACACTATTATACACAATCTATACCAATCCTGAGC
GTACCGGCGAGCTTCCAAAAACTCATGTCTGGCTTACTACTCTGTACTGC
ATTCACTACCTCTACCGAGCACTTCTCAGCCCTATACGAAACCCGTCGAT
GGGACCCATGAACATCGGCATGGTTTGCGCGGGAGTTTCGTTCAACATCA
TAAACGGTTCCGCAATTGGCGGCTGGCTGGGTGGTTATGGTTCCGCCGCA
GATGTCCCTGGCTGGCAGATTTCGATCGGAAGCGCCATGTTTATTCTGGG
GCTCTGGGGGAACATGTACCACGAAGAGATCCTACGAGAAATCAGAAGAG
ACAAATCTTTCGACAAGGATGCTGAAAAGGAGGGTAGAGTGGTAACGAGC
AATGAGAGAGTCTATAAGATCCCCGAAGGCGGTCTATTTAAA

Sequences in the Contig:

SY0AAA50YH11FM1 SY0AAB10YH13FM1