Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig145
Length(NT) : 1000
Best Gene Model Blast : Link to GSTUMT00007440001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein NCU05294
Accession: ref|XP_962065.1| Score: 130 E_value: 1e-05
KEGG Definition: hypothetical protein
Accession: ncr:NCU05294.1 Score: 130 E_value: 5e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig145
TTGGATACCTGCTATGGCTTATGATTCAACGGGGTTGATGGAGGGAATAT
TGGCCCTAGCAGCAATTCAGATAGGGCTGATGAGAAAAGACCCCCGCATA
ATAGCAGTCGATGCTGCTTCGCATTACCATAAAGCGTTAAAGGCGCACTT
TAGGGCTGTTGCAGACCCTAACTGTAGATCAAGAGACTCACTCCTCGCTA
CAAGTATAATATTAGGTCATTACGAGGTATTCTGCCCTTGGCTCCTGCTT
GTTTCGTTCACTTACTTTCCGTGCCACCAAGATCTGGAATGGGGAAAATG
TGAAAATGGGCGTTCACATGTTGGGAGGAAGGGACATAATACTGGCTAGA
GGCAAAGCAGCCCACATGACGCCAGTGGGGAGAGCCCTTTATGCTGCCTT
CAATAGAATGGATGTAGCCACCTCGAGTATTAGCGGAAACCCAACATTTA
TGACAAAGGATTGGTGGACTGTTGACCCATTCACTCGCGTTCCAATTTCA
ACCGATTCCCCAACCCTTCTGGTAGCTGACGCCGCCCTCTCGAAGCTCTG
TGTGCTCTGCTGTAAGCTTACCTATCTTAAAGCTTGGTCGCTGAAGCGTA
GGAGGACCCTCTGGGTTAAATCCAATGGCAACCCCTCCCTAAAGCAAAAG
GAATCACTCCAAGAAACCATTGAAGATCGAGTATTAAAATTAGAAGAAGA
GCTTGATATATGGTATGCCGAGCTTCCCTCTTGGTTTTCTGCCCTTGACA
CCGATCCCCCGGACTACAATCCTAAAGGCGAAGACATCAACACAACTTCA
ATCGCTTCGATTACCGTGGGAAGCTATCAGCATATATCTATAGCCATGGT
CCATGGTTGGGCAATCGGCGTCAGGCTTCAGTTAAACCGGATAAGCAACC
CTGACATGCCAGTTGTTCCACCTCGCCTAGGCTCTTTGTGCCACACGCTC
CTCCGTATATTTGCTTGTTTACCGAGCTCAAGTGATGCATGCATTGTGGC

Sequences in the Contig:

SY0AAA15YE16FM1 SY0AAA6YI23FM1 SY0AAA8YI06FM1