Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1449
Length(NT) : 1423
Best Gene Model Blast : Link to GSTUMT00002116001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001541807.1| Score: 457 E_value: 2e-43
KEGG Definition: hypothetical protein
Accession: ang:An02g04130 Score: 420 E_value: 2e-39
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0274 Score: 162 E_value: 8e-12
PFAM Definition: No Hit Found
Swissprot: P87053|POF1_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0019005 = Cellular component: SCF ubiquitin ligase complex
GO:0005515 = Molecular function: protein binding
GO:0042787 = Biological process: protein ubiquitination during ubiquitin-dependent protein catabolic process
GO:0046686 = Biological process: response to cadmium ion

Sequence:
>Contig1449
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCAAAACCCCAGAACCCCCTA
ATAAAACTCCTTCTAAACCTGTTTACAGACAAACTCAAACGCACACACTT
TACATCGCATATACTATATACTCGAGTACAATACATATCACGCTCGCGGG
CATCTTCTGCAAACCTTCTTTGCTCAACTCCCCCCACACCCTACATCCTC
ACCTGCACACCGTAGACTAAGCCAGCACGTTGCAGCGCACCAGCAGCAGC
ATTCCTCCGTCCATTTCATCCACTACATCCGTTCCTTCCATCCTTCCATC
TACACGCTCATCGATTGTCCCCCGCTTACAGTTAAGGTTTAACCTTAGTC
GCTGTCTCTGTATGCTTCTTAGTTTCTATTTCGCTCAAGGCTTACGTCAA
TTTTGAGCGCAAATTTATTCAATATCCTTCCCTTTATTGCCTTGTTCAAT
TCCCGCCCAACACCCTGTTGTCGCGACCGCGCTCTCTTCCGCTCATTCAT
CATCATCATCGCCACCACCATTATCTGTTCGCTTTGCTGGCTTGCAGATA
GCTGGGATCCGTTACCAAATTGTTCGATTCTGTACCTTTGGCTTAAGCCA
CACAAACCCTTGTCTGTTTATTTTCGTTTATGAAACTACAGTTACGAATC
GACATCGGATACCCTTGTTGCTTGACCCAACAATCTTCGGATTGTGCAGC
CATTTGCCTTTACGCCCAAAAACCTAACAAAGCCGACCCTAGGTATATAC
GACGTTGACGGAACTGGCGGCTTTATCCAAGCAGTTGCAGCTTTTATTTA
TCATTGGAAAATGGAAGGGGGTGATTATAGGAGACCCATGAGTTTTAGCA
CACGTCGAACGTCGGACTCGGATACTGGCGATATGGACGGGAGTGGAATA
TCCGGTATGGGTCCACGTCCGGGTCGCTTGTCTGGAGCATCAAGGAGACC
AGAGGCAATAACACATTCACATCCCCGACCTTTACCTACACCCACACGCC
CTATTGTGTCGCCCTTGCAAAATCTTCTCCCATCTGCACCCGCAAGTCCA
CCAACCCCAGCGCCCTCACCAACGCCGCAAATCCATCGTTTACCAACATG
GTCAACTGCAAGTGAGAGTGAAGATGCTTTTTTAAGAGATGCTAGACCTC
ACTTTAGTAGGTTGGATTCCCAGGAACGGCAAAGATTTTTAGCCGAAATT
TTGAATCTTTGCGACTCGCAGCAGCTCAGTTTCGTGCTTAATTATGTCTC
GCCTCGACTGAAAAAGGATCCTTTCAAGTCTTTGCCGAATGAGCTATGTT
TAAGAGTAATCTCATTCATCGATGACCCGAAAACACTAGCAAGAGCATCA
CAAGTATCCAAACATTGGCATGGTCTCCTAAGCGATGATCTTACATGGAA
AAAACTTTGTGAGAAGCATAGTT

Sequences in the Contig:

SY0AAA11YD06FM1 SY0AAA50YG24FM1 SY0AAB43YA12FM1
SY0AAD11YC05FM1 SY0AAD34YJ06FM1 SY0AAD35YJ06FM1