Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1448
Length(NT) : 653
Best Gene Model Blast : Link to GSTUMT00005088001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein HCAG_02375
Accession: ref|XP_001542204.1| Score: 214 E_value: 8e-16
KEGG Definition: hypothetical protein; K07126
Accession: ani:AN0810.2 Score: 212 E_value: 7e-16
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q9USV1|SFR1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0000790 = Cellular component: nuclear chromatin
GO:0032798 = Cellular component: Swi5-Sfr1 complex
GO:0042803 = Molecular function: protein homodimerization activity
GO:0045132 = Biological process: meiotic chromosome segregation
GO:0000709 = Biological process: meiotic joint molecule formation
GO:0000725 = Biological process: recombinational repair

Sequence:
>Contig1448
TTGGCGATCATCTTGACAACTCAGTTCAAATGCCCGATTCCCCGGCTGAA
TCCTCCGTGTCGGATACCTCTGCTATGCCAAAAGGCCCTGCAAATTCGGA
TGTTCGAGAAGCGAAACGCCGTCGGCTCAGTATAGCAACAAACACCTTGT
CAAAACCTTTCCGCTCACCTCTGCTCTCCAAACCTCGCTCGACTGCTACA
ACTCCTTCTCCTACAAAATCAGTTGCTTCATCAGTGGGATCTCCTACCTC
TCCGGTTACAGATGCTCCAATAGCTACAAATCGTCGCCGTCCGAGCCTTC
AATTTACCACCAGACGGACTTCCTCAGCCCCTCAAAATCCTGAGTTAACA
AAGCTGTATAAGCAGCAATCAACCTTGGAGGCAAATTTGCGGGGGAAGAG
GGCATTGCTAGACACTGCAAAACAGGCTCTGAACATCGAGACGGCAGCCG
ACGGGCGTGGTGAAGAGAAATTGCAAGCGTTGATAGAGAAGTGGAGGACG
GCAGCCAGCAGCGCAGCAGATGCGTTATATGAGATAACTAGTCAGAGAGC
AACGAATGCTGGCCCTGGAGGTTGGAAGGAATTAATTGGGAAAAGGGGTT
GGGACGATGATGAAAAACAGCCTACTTATGGAAAAGGTGGCGAAGATGAG
GAG

Sequences in the Contig:

SY0AAA50YG16FM1 SY0AAC40YL14FM1