Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1447
Length(NT) : 643
Best Gene Model Blast : Link to GSTUMT00007032001 E-value : 1e-134
Numbers of ESTs : 2

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001543717.1| Score: 173 E_value: 4e-17
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1447
TTGGCAAACACTTCCTACTTCACCCCAGGTGTAAACACCCCTTCCCTTTC
CGTTAGAGCATGCCCCCCCACCAATTCTCAGTCAGAGCGACAACATTGAC
ATATCATTAAGCAATCAAATATGCCGAATATCGATCGCTCCGGATGGCGT
AATACTTTCATCTACTCTTCCAACAACCGTGGTACTATAATCGGAGGTCT
CTGGGCCGCGGAAGGTATTACCAACGCCAATTTCTATTCCATGATCGGTA
TTTTCTGTTTGTTTAGCGGTACTTTTGATCTCTACAATGAGAGTGAACGA
TTGGTTGAGAGGGATTCGCAACAGCTTCAGCCAGGCAATTACTATATTGT
CACTGATGGTGGGTTTTTTCTGAGCTTCGATCCTTGGCCACCGCTCACTC
AGAGCAGGTTCCATCACCATCACCGACGAGGTCCCGCTAACCCGTACGAA
GTCGGTGACGTCCGGAACCCGAGTTGAATCATTCCGCGATGCCGTGCGCG
ACCGAGACCAGGGATGCGTGATAACCAGCACGAGGGCACCGCTAGCTCAT
TTTGGCAACTGGAGATCCTTCGAAGTCAGTCATATTTTTCCTTTGGCATA
CGAACAGCACTGGAATCAGTGCAACTATGGTCGTTGGATCACC

Sequences in the Contig:

SY0AAA50YF20FM1 SY0AAB53YJ03FM1