Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1446
Length(NT) : 1737
Best Gene Model Blast : Link to GSTUMT00005887001 E-value : 0.0
Numbers of ESTs : 12

Blast Results:

Nr Definition: hypothetical protein BC1G_04631
Accession: ref|XP_001556915.1| Score: 700 E_value: 2e-71
KEGG Definition: hypothetical protein
Accession: ang:An08g02230 Score: 534 E_value: 1e-52
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1446
TTGGACAGAATACGGAGTCAGTCTAACGAGGGAGACGGGAACCAATTAAA
CTGCACCTCTACCGGGTATTCACACAAAACCAAACAACCGAACTTGCGAG
GATACCCTACTAGTATCATACTCACTCTGAGAAGCCGATACATCTCAGAA
ACATATCCGGTTCCGGCCAACTTTAGGCCACCTTCTCCCATCATCCCTCC
AAACAATGCCCGCAGCAGCAGCTCCTCGAAAGAAAACACATGCTCGTACA
AACACCGTTGAACTTCAGGAATCAGCTCGTCTAGAGCTTGTCGTTCCTCA
AGAATCAGATCTAGACATATCTCAGGCAATAGATGAAGCTCTCAAGCGGG
ACAAACAGCGGGTCTCTACCGCTGATGGTGGGATTTCGGCTGTTTCTGCA
ATCGAACAGCGCAAATCCCTTTTCTACGATGAAACCTTGCCGGTATTCGT
GGTTCTTCAGCTTCTAATCCCCCTAGAAGATAGTGTCTACGAATCCTATC
TCTCTCGTCTTGCCGTTTCTCTCGAAGTAGCCGCTGTAGATGGCCAACGG
CAACAGCAGCAGCGGCAGCCACAATATGGGGGAAGGCCCGCGGAGACAAT
CCATCTGTTATTCCAAACCGTGGTGGATGAAAACGAGACAAAGCGAATCG
TCATAGATAACGGTGCACAGAGACTAGCAATATGGAAGATTGACGTGCCC
CTAGGGCATCCCCGGGCTCGTCTCAACAACCCAAAGGTCATATTAACGGC
TTCGGCTACCATACGTCCAGCTGAACTTCACAAACCTGTTGTCGAAGATG
AATATCTGTCGACCCGACAGCCTGTTGGAATTAATCTACTCGAGTCTTTT
GCCGAAGATCCATATCTATCCACTGTTGCTCCTCGGCTTTCTGCTTCAAG
AGTTTCCCGGGTGATACCTGTGACCCAGACGCCACAGCAAGCTCTCCGCC
CCTTCGGTTATGCTGCGAAGCGCAATTTCAATATCTACCCAGCCATTAAC
ATCCGACTGCGTTACTCCCGTATCTTTTCCGGAACAAAGCAGACTATCAT
TGCTTCTCTGGATTTGGAAGTGACACACTTCAGTGAATGCGATGTAACTA
TAGAGAGTGTTGAAATTGCACTGTCTGGCGGGAAAGCCAACCCCCTGACA
GATTCGCCATCTCCTTCTTTACCTATAGAGTGTCGACCACGAGATGATAT
AACATTCTTATTTATCCTAACACCGACCGATTTGCTCCCCACGTCCGGCT
CGCCAGCCCCAGCATCATCTAATTCGCCAATACGTCCTATTTCCGTCACC
TTACAAGCGACCGCCCACCTCTCGCCAATATGCCATCCTAAGATATTTAC
TAATTGGACTACAACTGTGGACTTTTCACCACCACAAAGCCCCACCTTCC
AACCCTCGCCTGGTATTCAGCGTGCCCATCGGCCACCTTCCCTAGGAAGC
ATCATCCATGGTGCCACCGTTTCATCATCGGCCGGGATCCGTCCGGTCCA
TCAACCCGCCGCTCCATCCCCTGCTCTAACTTTCACACCGCCGAACCATT
CTACCCCCTCTTTTGTAGCGAACCCGGCGCCCGAGAGCACTCCAGGCCTG
ACCATAACATTCTCTGGCCCATCGAGAGTATATGTCGGTGAGATCTTCGT
CTGGACCGTCTTTGTCGTGAACCGCTCCCAGCGAACCCGAAAACTCGCGT
TAATGGTCCCACCGAAACGCCGGAAGGCCGGTGAAGG

Sequences in the Contig:

SY0AAA14YD11FM1 SY0AAA3YK06FM1 SY0AAA4YP08FM1
SY0AAA50YF09FM1 SY0AAA62YN22FM1 SY0AAA9YB20FM1
SY0AAB16YA01FM1 SY0AAC40YO23FM1 SY0AAC7YO08FM1
SY0AAC9YO13FM1 SY0AAD55YA04FM1 SY0AAD61YH11FM1