Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1445
Length(NT) : 1511
Best Gene Model Blast : Link to GSTUMT00000094001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SS1G_03429
Accession: ref|XP_001595340.1| Score: 542 E_value: 3e-53
KEGG Definition: hypothetical protein
Accession: fgr:FG08948.1 Score: 471 E_value: 3e-45
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG1830 Score: 113 E_value: 4e-06
PFAM Definition: Atrophin-1, Atrophin-1 family. Atrophin-1 is the protein product of the dentatorubral-pallidoluysian atrophy (DRPLA) gene. DRPLA OMIM:125370 is a progressive neurodegenerative disorder. It is caused by the expansion of a CAG repeat in the DRPLA gene on chromosome 12p. This results in an extended polyglutamine region in atrophin-1, that is thought to confer toxicity to the protein, possibly through altering its interactions with other proteins. The expansion of a CAG repeat is also the underlying defect in six other neurodegenerative disorders, including Huntington's disease. One interaction of expanded polyglutamine repeats that is thought to be pathogenic is that with the short glutamine repeat in the transcriptional coactivator CREB binding protein, CBP. This interaction draws CBP away from its usual nuclear location to the expanded polyglutamine repeat protein aggregates that are characteristic of the polyglutamine neurodegenerative disorders. This interferes with CBP-mediated transcription and causes cytotoxicity..
Pfam Number: pfam03154 Score: 111 E_value: 7e-06
Swissprot: P87323|MCS4_SCHPO
Gene Ontology:
GO:0000935 = Cellular component: barrier septum
GO:0005737 = Cellular component: cytoplasm
GO:0007346 = Biological process: regulation of mitotic cell cycle
GO:0046685 = Biological process: response to arsenic
GO:0042542 = Biological process: response to hydrogen peroxide
GO:0031098 = Biological process: stress-activated protein kinase signaling pathway

Sequence:
>Contig1445
TTGGATCATCGCCATCACAACCGACAACTTCCCTCCCCTTCCCCTGTGAG
GAGCCTCTCGCTTCCACCAAACTAGAGGATTGTCCTCGGTCCCTGCAAAG
CACGGCGGAGATCTCTGGTTCTGGACCCCCTATCGGACCTCCTCCTCTTG
CTATTATTCCTACACCAGTTTCCGGAAAAACCTCCTCGACCGCCTCTGTA
CCTCTGGATCTGGCAAACTCTCAGCCGCCCTCAAAGGGAAATCTTAGGCC
AGCACTTTCCGACCGACCTCCACATTCACCACCTCCTCCCCCGCCAATTC
AAACACACCGCCCTGGCCAAGACCGGAAGCAATCGCTTCTACCGGCCTCT
GAGTCTGCCCTGGTTCAGGCTCTCCTCGGCTCTACTACCAACAATACTAC
TGCATTGCCAAAACCTAATACAAGCTCGCCGTTACTGGAGGAGTCATCAA
TTACTTTTCGTTCGGTCCCCGTCGAGTTTCAATTGCCCACTCCGGCTACC
CTCGGGTCAGGTATGCTGAACGGGAGGGTTTGGGTGAAGAGACCTGGGGG
ATCACCCACCATTGTCAATGTCCGTGAGGACGATATGGTGGACGATGTTA
GAGATGTGGTCCTGAAGAAATATCAGAATGCATTGGGAAAATGCTATGAT
GCTCCGGACATTTCTATAAGGGTTGTTCCTCGTCACTCAAGACCACGCTC
ACTTGATCACACTCCGGGCCGTAGCTATGATTCACAGCTTGGCGAACGAA
CGCTCAATCCAAACGAGACGGTTATTCGAGTACTGGATGATTATTTTCCC
GGAGGTCAATCAATTGACGAGGCCTTGATTATCGAAGTGCCCTCGCTGCC
ACCTGTTGGGCGGAGGACACCTCGCCCATCACCGCATCATGGCTTTGGAT
CTCATCATGATGGCCACTCTGGCGTGGAAATCAATGACTATTTCTCTCCA
ATGGCATCCACAGGCTATCCACAAGCACCACCATCGTCATCCCAGATATC
TTTGAGGGAACCCTCTATCGCAGTTTTGACAACAGGCCAGGTGCCAAACC
TGCCTGGATCACCAGGGAGTACTGGTCGGAGGGGTGTGCGTCCGGGCACT
AGACGTTTGCAAACCACATCTCCAGTTGTCCGCCCATCGGCTACCGAAGT
GAGCTCAACAGCAGGACCCGGAGTAGTCCTGATGCCTCGCCAGAATCGTT
CAAGGGTCAACTCCGATGCATCGAATACTGCTCAACCCCCCCAACCCCCT
CCCATATCTGCACCCGCTGTGGAAGACAACACCCAAAAAGCCTCTACCCC
TCCAGCCCGCATGGCATCCCCTCTTGCAAAGAAATTCAAGGAGAAGAAAC
AGCATACTTCGCCGGCGGGCTTATTACCCGATGGTGCTGTTCCTCCTATC
AATGTCCTCATCGTCGAGGACAATGTTATCAATCTTCAGCTGTTAGAAGC
GTTCATGAAACGCCTCAAGGTTCGCTGGCAGTCTGCCGTGAACGGGAAGG
AAGCCGTGGAC

Sequences in the Contig:

SY0AAA45YD11FM1 SY0AAA50YF06FM1 SY0AAC8YL06FM1