Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1444
Length(NT) : 590
Best Gene Model Blast : Link to GSTUMT00003393001 E-value : 1e-107
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1444
CATGAAGATGAAGCTAGATAATAATACACCTATGCAAAGTAAAGTATCCA
TGATCCATGATTTAAGCTACATACCATATTGTGTGCCTTCCCACCACCAC
TTTCACAAAAATCAGGCGCCGACACCAGCAAGCAAGCAAGCAAACAAGCA
AAGAGAAGAAGGTGGAAAAACTAAACCTAGCGAAACCGAGTGGCATCAAA
AAATTCAAAAAATTCAAAACAGGAACAAAAGTAAAAACTCTCATACGGTA
TCATCTCGCAAACATACGCTACGCTAAGCCTAGGCAACTAATATAAATAA
CAAAGGAGACGGCAACAAGATATCACAGGATCTCATGATAATTTCCGTCT
TCACTTTCAACAAAACAGCCCCCCAAACAAACACACAAAGCAAAGCAAGG
CTTGTCACAAAGCAAAGTAAAGCATACCCATTGCTGAAAAAAAGAAAGGA
AAAGAATCTTTACCCCGAAAAATGAAACCCCCCACCCATAACACAGTGGG
CATGGCTCGAGATAGGATGAAAAGAGAAATGAAAAAAGAAAATGAAAAAA
AACATGACCCAGTACAAACCCCCCACCTCCCCAACGGTTC

Sequences in the Contig:

SY0AAA22YN09FM1 SY0AAA50YE21FM1