Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1443
Length(NT) : 1083
Best Gene Model Blast : Link to GSTUMT00011725001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1443
TTGGCACAAGTCAAGCTCCGGATTTCTAAGAACCTGTCAGTACAGAACAC
ACACACCCGGGAAAGAAAAACAGCCCAAACTCCGCCGACCACAGGACTCA
TTTCTGAGTCAACCGGCCCTAATACTACCCCTAACTACATCGAAGACGCC
AAAAAGCCCCCCGCCGAACCAGAACACGAGCGATGCGTTGAATGCGGAGA
TTGCTACTGCTCTCCAGTAGTATCCGAAGCTCGGGCAGCGGAAGATCAAC
AAGGTCCGGGGGGTAATGGTATTTTGGTCCTCTTATGGGGGCAGGAGTTT
AAGGAATGGTTGAACATTGTTTTTCTTGCAGGCCAACAGGCAAGTGCGAA
AAATCATAGAGCCCCAAATCCTGACAGCGGCCTTTTAAGCTTCAAGAATA
TCGAACTTAATGCGGGCGGGAGCTCGGGCTACCCCTTGATGGATAGAATA
GAGAACCAAATCTTTCGGATCGGAGCGGAGTTAGAGGTATCGGCAAACTA
TGGCACACATTCGCGACTGCACCGCGACTTTTGCAATAGCCTGAAGGTGT
CCACCGAGGCGGTGGGGTTATTTTCCGAAAACGATACAGAATACATACCG
AGTTTCTCTGCTCTTGGTCCAATTGACACGAATGGAAAAATCCTAAATCA
TGCTACAGGACGCCAATCGGAAAATAATTTGTCTAGATCCAGCACGTCTT
GGGTCAAAGGGATCTTACAAAAGGTACTGAAGCAGCTTGCGTGCTTCAGA
TACGACTTTAATGAAACTATCAAGATAAATATTCATGTCGGGATGGAAGC
AGTCTCAGGCTACGAACTCAGGGAAATCAAGACGATATCTAAGGCCATTG
TTTTATTTGGAGGGCTGCTCAATGGCATAGGGCTCGGCCCCAATCCGGGT
CACTACAAATGCTGCCCCGATCCCACCGAGAGGGTCCCCTCCAATGCGAA
GCATATTCAAGCCATAGATAGGGCATCTTCAATCGAAGACGTTGCGCAGC
TCATGAACTCCCTAGAGGCATCGGGCTATACTTACCACGGCGAACCAGGT
CTAGAGAACCAACGTTATGACTTCAGTTGTCTT

Sequences in the Contig:

SY0AAA50YE15FM1 SY0AAA54YB12FM1 SY0AAB20YF06FM1
SY0AAB20YO10FM1 SY0AAB26YK13FM1