Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1441
Length(NT) : 1209
Best Gene Model Blast : Link to GSTUMT00007543001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1441
TTGGCCCCCCTCTTCAACTGAACAATGGACCCCCAGTTGCGAACTGAGGC
AAAGAAAAAAAAGGCCGTCAGGTGCCCCTGCATTTTTAAGCGTATTGTAC
GTACGAGTACAGCAGAATATTACCATGGCACAATATTTATGACTTATGAC
ACCTCGTTTGGGGCCGTTGCAGACTGATAGCCCATTATATTGCGTTGATA
TCATGATAAAAATCAATGCCAAGATACCGTGCGATGGGAGAGCCTCCCCG
CTATTAGGCAGCACTGGCCCGATAGCAGGTTTGCCTACCTATCCCACTTT
GGCGGGGTATAAAACCCCCCCGCTATTGGGCTAGAGCTCTCAGAATCTCC
ATCAACCGCTAACCATCACAACAAATCGCTACTCGAGCACTTTCACGCTT
ACGAACAGCATCGCATCACCCTACCGACTCGAACTAAAAACGTCATAGCT
GTGTCTGCCCTATCTATCATACCCTTATCTACTCGAGTACTGCAGACTGG
TCAAACCCTACTATCCACCCCTCTGCGTTCATTCAAAACTGCCTTAAAAC
CCCCCCCCAACATCACCACCGAAAAACCTTCACCAAAAACATCTCATAAT
GACTCACTACCTCCAACGATCAACCAGAAAGTCCGATTTACCAATCCCCC
TAGACTACCGGGTGATAGACGTGCTCCTGGAGCTCTGCCGGAAGGGCGAA
CTCAAAGAGCTGCAGGAACTGCTCTTCACGCTGGCGAATGAGGCCCCGCC
CTCGGTCCTGCCCCTGGACCTCCTGACCGCCTCCAAAGGCAAAGAATCAT
TGAACAACACCCTCCACATGGCCTCCGCGAACGGTCATTACGAGGTCGCC
AGATACCTCCTAACCCTGCTCCCCAGGCCCACCCCGACAAACCCAAACCC
ACACAAACCGCATGCATTCGTGGCCCACGGTCACCAATAATGCCGGGCAC
AACGTTCTGTTCGAAGCCCAGTCGGCTAATAAGGAGGATGTAGCCAAGTT
CCTCTTGGAAACATGTCCGGAGTTGGCGGCCCCTATCGGACGTACGGAGG
AGGTGGTGATGGAGGGTGAAGGGGAAGGGGAAGGGGAAGGGGGAGCGGCA
GAAAAAGGGAAGGGGAAGGAAACCGAAGGGGTCACCGGGGGAATGGGAGA
GCTGGAGATTTCTGCTGGAGATACTAAAACTAACAAGGCTGGGAACGCTT
GAACAGTGA

Sequences in the Contig:

SY0AAA50YE09FM1 SY0AAB26YA19FM1 SY0AAB36YA01FM1
SY0AAB37YA01FM1 SY0AAB40YE11FM1 SY0AAC31YB24FM1
SY0AAC41YA01FM1 SY0AAC6YC07FM1 SY0AAD3YG19FM1