Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1440
Length(NT) : 968
Best Gene Model Blast : Link to GSTUMT00000084001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE62816.1| Score: 1196 E_value: 1e-129
KEGG Definition: RhoGEF GTPase
Accession: aor:AO090120000205 Score: 1196 E_value: 1e-129
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG4305 Score: 800 E_value: 4e-86
PFAM Definition: RhoGEF, RhoGEF domain. Guanine nucleotide exchange factor for Rho/Rac/Cdc42-like GTPases Also called Dbl-homologous (DH) domain. It appears that pfam00169 domains invariably occur C-terminal to RhoGEF/DH domains..
Pfam Number: pfam00621 Score: 344 E_value: 4e-33
Swissprot: Q9Y7U6|RGF1_SCHPO
Gene Ontology:
GO:0000935 = Cellular component: barrier septum
GO:0051285 = Cellular component: cell cortex of cell tip
GO:0005634 = Cellular component: nucleus
GO:0005515 = Molecular function: protein binding
GO:0005089 = Molecular function: Rho guanyl-nucleotide exchange factor activity
GO:0006075 = Biological process: 1,3-beta-glucan biosynthetic process
GO:0048228 = Biological process: actin cortical patch distribution
GO:0051518 = Biological process: positive regulation of bipolar cell growth
GO:0035025 = Biological process: positive regulation of Rho protein signal transduction
GO:0008360 = Biological process: regulation of cell shape

Sequence:
>Contig1440
TTGGGGAGAAAAAGAGGCAGGAAGTTATTTGTGAAGCTATCTACACCGAG
CGAGATTTCGTGAAGGACTTGGAATATCTTCGAGACTTCTGGATGAAACC
ATTACGCTCGACAAATCCTCAAAACCCCTCACCCATCCCGGAACACCGCC
GCGAAAGGTTTATTCGCACAGTCTTCGGAAACGTTCTGGAAGTCCATAGT
GTCAATTCTCGTCTTGCAGAGGCACTCACTCGAAGGCAGCAGCAGTCTCC
GATTGTCCACAACATCGGAGATATCTTTCTCGAATTTGTACCCCTATTCG
AGCCTTTTATCAAGTATGGTTCGAATCAGTTGTATGGAAAATATGAGTTT
GAAAAGGAGAAGGCTGCTAATCCCAATTTCGCTCGCTTTGTGGAGGAGAC
GGAACGAATGAAGGAATCGCGGAAGTTGGAACTCAATGGCTACCTCACCA
AACCGACAACCCGCCTTGCCCGATACCCATTGCTACTGGAGGCGGTAATG
AAGCCGACAAGTGATGACAACCCCGACAAGAAAGATTTACCAAAGGCCAC
TGAGCTTATTCGAGAGTTCCTCACGAGGGTAAATATCGAATCTGGGAAGG
CCGAGAACCACTTCAATCTTATGCAACTCAATGAGCAATTGATCTTCCGA
CCCGGGGAACATGTCGATCTAAAACTAACTGAAGAGGGGAGGCAATTGAT
TTTTAAGGGAAGCCTTAAGAAAAGCGCAACACAGGATGGTGGTGGAGATA
TTCAGGCTTTCTTGTTTGATCATTCATTACTCTTGGTCCGAATAAAGTCA
GTCAACAAACGAGAAGAGTATAGGGTGTACCGAAAGCCAATCCCGCTTGA
GTTGCTTGTCATTGCTCAAATGGAAGAAGTTCTACCCAGGGCAGGGATTC
CAAAACGCCCGTCTTCAAGTCTTATCCCAGGGACTAAGGCTATCAAGAAT
ATCCCTAACGATTTTAAC

Sequences in the Contig:

SY0AAA50YE04FM1 SY0AAB19YI14FM1 SY0AAB52YN15FM1