Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig144
Length(NT) : 448
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG1924 Score: 106 E_value: 4e-06
PFAM Definition: DUF1421, Protein of unknown function (DUF1421). This family represents a conserved region approximately 350 residues long within a number of plant proteins of unknown function..
Pfam Number: pfam07223 Score: 104 E_value: 7e-06

Sequence:
>Contig144
TTGGCCCGTCATAAAATTCCGATTTTCTGTGCTCATACATCCCGGTACCC
TACCTACTAGTTTTTGACAACGTGAAGATCTATCATACTCGATTATCGAA
ACAAAACATCATACAGTTGCTCACGGTAACTCGGCTCAACTCGACTCAGC
TCTGGTTAACGGAGGAAGGAAGGAAGGAAGGAAGGAAGCTTTTGCTCCCG
GTTGTTTCTCGGTCGACCACGATACCTTATCATAAGCTTCAGTTACAACA
TCTTCATCTCTCTACCACCGCCGCCGCCGCCGCCGCCACCTTAAAACAAA
AACACAAAAACACCGCACATCTCCACATCCACCCACCTCCATCAACCAAG
CAGACAATGTCAACCCCCCCCTCAATCTCCCTGACCCCCGCAATCACCAC
CACCGCTACTACCACCCCCCCACCTCCGCTCCCAGACGACACAGACTC

Sequences in the Contig:

SY0AAA15YE12FM1 SY0AAA20YH09FM1 SY0AAB31YH17FM1
SY0AAB51YE20FM1 SY0AAD17YI06FM1