Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1439
Length(NT) : 856
Best Gene Model Blast : Link to GSTUMT00010784001 E-value : 1e-109
Numbers of ESTs : 2

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57037.1| Score: 306 E_value: 3e-26
KEGG Definition: ankyrin repeat
Accession: aor:AO090001000528 Score: 306 E_value: 1e-26
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1439
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCAGCAAAAACAAAAAATGTC
TCAACGTTTCAGTAACAACATCAACTGTTGGAACACGACCATTAACTGCA
ATGTTGTCGATACCCGATCTGATATCCTAACATGGTTATCTCCACTGGAT
CCCAAGTCACGGCATCAGGAAATTCGGGACCACCGGGTCGAAGAGGTAGG
GAAATGGCTTCTACAAACCGAGGAATTTAGAAGCTGGTACGCTAGTAGCG
AGGGAGGCGAATCCGATAACCCAGTTTTGTTTTTCTACGGAGATCCCGGT
GTGGGTAAGACTTATATGAGCTCATTGCTCATAGACAGCTTATGTGGTCA
GGTTGAAGGCCAAAATGTTATCGTTGCATGTTTTTACTTCGACTTCACCA
TCCAAAAGGAGCAGTCCCCCACGAGCTCGCTGGGCGCTCTTCTAAAACAG
CTAGTTGGCGGACTGGAGAAGATCCCGGAGGATATATCTCAAGCGCGCCA
ACACTCAAAGAAACAAATTGATGGGCGGAAACCGGAACTCGGCGATATTG
TAGGGTGGCTGCAGAACGCCTCTTCCAAAGAGCGCACATTCATATGTATT
GACGCTCTGGATGAATGTGTGGAAGGATATCGAGTCAGGCTTCTTGATTC
GCTAAATAAAATCCTCCAAAAGTCTCCAGGGACTAGAATATTCGTGACCG
GGAGACCGCACATTCGACCTGAGATTGGAAGGCGTCTTGGTGGAAAGGTA
ACAAGTGTATCCATAAGCCCCAAGAGAGACGATATCATTAGATATATCCG
CACCAGGTTAGCCCTGGACCCAAACCCGGATGCGATGGACAGTAGTCTGG
AAGCAG

Sequences in the Contig:

SY0AAA50YD09FM1 SY0AAC43YN16FM1