Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1438
Length(NT) : 706
Best Gene Model Blast : Link to GSTUMT00009848001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SNOG_05914
Accession: ref|XP_001796308.1| Score: 908 E_value: 3e-96
KEGG Definition: hypothetical protein
Accession: fgr:FG01916.1 Score: 873 E_value: 2e-92
KOG Definition:
Classification: [Carbohydrate transport and metabolism, Posttranslational modification, protein turnover, chaperones, Signal transduction mechanisms].
Kog Number: KOG4626 Score: 447 E_value: 3e-45
PFAM Definition: No Hit Found
Swissprot: Q9M8Y0|SEC_ARATH

Sequence:
>Contig1438
TTGGGAGCAAAGGTTATCCGACTCATCGAGAGGGCATCTCGCAGGACTGT
CTGGAGGTGGTATCAGGAAAAATATGTCCAAGGTGTTGAGAAATCCTTGA
ATGAATATTCCAGGCCCACAGTTCCATCAAGCCTGTCAACCCCAAGCGCC
CCAACAGTTCTCCCATTCCATACATTCACCTGTCCGCTTTCGGCCAAGCA
AGTCAGAATGATCTCTCAGAGGAATGGTTTGCGAATATCCTGTTCTACAT
TACGAGCCCCATGGCTTCCGCCTCATGTTTTCCCACCACCAGCGCCACCA
GCACCCTGCCTGAAAATTGGCTATGTTTCATCAGACTTTAATAATCACCC
TCTAGCCCATCTAATGCAGTCCGTGTTTGGCCTCCATGACCCAGCCCGCG
CCAAAGCTTACTGTTATGCTACCACAGCGAGTGATAACTCAGAGCATAGG
AAACAGATTGAGAGGGAATCACCTGTGTTCCACGATGCCCACAGCTGGGG
GCCAGATCGTTTGGTCCAACAAATTGTCAACGACGGCATCCATATCCTAA
TTAACCTTAATGGCTTTACACGAGGTGCCCGGAATGAGATATTTGCTGCT
AGGCCAGCGCCAATTCAAATGAGCTTTATGGGATTTGCTGGCACTTTGGG
GGCCGAGTGGTGTGATTATCTTTACGCCGACTCGACGGCAATTCCTAAAG
AAACTC

Sequences in the Contig:

SY0AAA18YF08FM1 SY0AAA29YO05FM1 SY0AAA50YC09FM1