Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1437
Length(NT) : 1145
Best Gene Model Blast : Link to GSTUMT00009292001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SNOG_15475
Accession: ref|XP_001805622.1| Score: 939 E_value: 2e-99
KEGG Definition: aromatic amino acid aminotransferase and related proteins
Accession: aor:AO090102000498 Score: 924 E_value: 5e-98
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0634 Score: 708 E_value: 2e-75
PFAM Definition: Aminotran_1_2, Aminotransferase class I and II..
Pfam Number: pfam00155 Score: 154 E_value: 4e-11
Swissprot: O14192|AATR1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig1437
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCCTTCTGACGTGTGGTAATACCGATGGTTTTGGGAAGGTGATG
CAAATGATTGCCGAGAGGGGTGACAGCATGCTCGTGGAGGAGTACACATA
TCCGAACGCTATCCAGACAGCTGACCCCTATGGTGTAAACATATCACCTA
TCAAGGTGGACGCTGAGGGAATGCTATCTGAAGGAAAAGGAGGTCTTAGA
GATGTTCTCGAGAATTGGGACCACAGAAGATTCGGTAGAAGACCTCGCTT
AATGTACACTATCACAATCGGTCAAAACCCCACCGGCGCCACACTTTCTT
TGCAGCGCAGAAAGGAAATCTACCGTTTGTGTGAGAGATACGATGTGATC
ATTATCGAAGATGATCCGTACTGGTATCTCCAGTATACTGAATCCTCGCA
CCCCAAGGACGCCCAAACCCTGCCAGCCAACTCTACCGGAATGAGATATC
CTTTCCTGGAAGCCCTAACCCCATCCTACTTGACAATCGACACCTCTGGG
CGCGTCATCCGTCTTGATACCTTCTCGAAGACAATCGCACCCGGTTGCCG
TCTGGGATGGGTCACAGCACAACCAGCTTTCATCGAGCGCCTGACTAGAA
TCACCGAGAGTTCCACTCAAAGCCCCTCCGGCTTTGCCCAAGCGATGGTA
GTTCAGCTGTTGCGCAATATTTGGGGTATGGACGGTTGGGTCAGCTGGCT
AGAGGGACTTCGTGCCGCATACGAGGCTCGAATGAGAATAATGTGCAGTG
TCTTGGATGCATACAAGGAGAGCGCCATTGTCTGCGAGAGCAAAGACGAA
GATTCCATGATTGTGGACAAAGTCAGAATGTATTCTTTCGACGAGCCCAT
GGGTGGGATGTCCGTATGGGTTCATATCCACATCACTTCCCACCCAGCGT
ACGCCGCATACCTCGCTCGCGGGCACACTAAGCGAGAAATGATGAACCAA
CTGTGGAAGTATGGTGCTGAGGAACACATCTGTCTCCCATGTCCCGGCTG
GATCTTTGGCGCGAACAAAAACATCCAGGAGGACAACAGTGCTGAGTTTT
TCAGACTCTGTTTTGCGGCGATCGAAGCCGAGAGAATTTTGGAGG

Sequences in the Contig:

SY0AAA50YC08FM1 SY0AAC22YG04FM1 SY0AAC29YC16FM1