Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1433
Length(NT) : 898
Best Gene Model Blast : Link to GSTUMT00002325001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SS1G_10513
Accession: ref|XP_001588965.1| Score: 1042 E_value: 1e-111
KEGG Definition: hypothetical protein
Accession: ang:An01g03470 Score: 1030 E_value: 1e-110
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0941 Score: 687 E_value: 5e-73
PFAM Definition: HECT, HECT-domain (ubiquitin-transferase). The name HECT comes from Homologous to the E6-AP Carboxyl Terminus..
Pfam Number: pfam00632 Score: 326 E_value: 3e-31
Swissprot: O94275|MUG30_SCHPO
Gene Ontology:
GO:0000935 = Cellular component: barrier septum
GO:0051286 = Cellular component: cell tip
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig1433
TTGGGATACGGCGGATGATAATTTAAACTATGGCCAGATCGCGCGACGTG
AGGCACGGAGGAGGGGTCAGATTATACCCACAAGCGAATTTTATAATATG
CTGCTCGATTACCAAGACCTCATAGCTGACTTTGACGTCTGGGAATCGAG
GGCGTCGAGGTTTTGCTTTTGTCAATATCCGTTTCTGTTATCCATGGGTG
CCAAGATATCTATTCTTGAGCACGACGCGAAGAGACAGATGGAGGTGCAA
GCTAGACACGCATTCTTCAATAGTATCGCGAGCCGCAGGACTATAAATCA
GTATCTAGTACTGAAAGTCCGGAGGGAATGTCTAGTTGAGGATAGCTTGA
AGGGCATTAGTGAAGGGGTAGGTAGCCTTGATGACATCAAGAAGGGGCTA
AGAATTGAATTTATCGGCGAGGATGGTGTTGATGCTGGGGGCCTGAAGAA
GGAATGGTTTCTCCTGGTTGCTCGAGATGTTTTTGACCCAAGTTACGGTA
TGTTTGTATACGATGACGATTCTCAATACTGTTACTTCAATCCGAACTCC
CTCGAATCTTCGGAGGAGTTTTTCCTTGTCGGGGTGTTGTTTGGTCTGGC
TATTTACAATTCCACCATCCTGGACGTGGCCTTGCCGCCATACATCTTCA
AGAAGCTCCTTCACTTCACTGTACCGCATAGTCTCGCGGTGTCCTCCATC
CGCCCACCTTTGCATCACACCCTCGAGGACCTTGCTGTTTTTAGGCCCTC
ACTAGCCCATGGACTGCGCCAGTTACTCGAGTTTGAGGGAGATGTCGAAT
CGACATTTTGCCGCGACTTTGTCGCCGAAACCGAAAGGTTCGGTCAAGTA
ATACGTGTGCCGCTCTGCCCCAACGGCGAGAACCGACCCGTGACCAGT

Sequences in the Contig:

SY0AAA50YA05FM1 SY0AAB37YA24FM1 SY0AAC49YA19FM1