Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1432
Length(NT) : 3013
Best Gene Model Blast : Link to GSTUMT00010835001 E-value : 0.0
Numbers of ESTs : 66

Blast Results:

Nr Definition: hypothetical protein CIMG_07972
Accession: ref|XP_001240809.1| Score: 1502 E_value: 1e-164
KEGG Definition: hypothetical protein
Accession: ang:An02g03160 Score: 1475 E_value: 1e-161
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG3589 Score: 181 E_value: 1e-13
PFAM Definition: RGS, Regulator of G protein signaling domain. RGS family members are GTPase-activating proteins for heterotrimeric G-protein alpha-subunits..
Pfam Number: pfam00615 Score: 279 E_value: 5e-25
Swissprot: P38093|FLBA_EMENI

Sequence:
>Contig1432
TTGGGTCGTCGCCATCGCCACGTGGTTCTGATCGTTTATCTTCACTTGCA
TCCTTCGTCGACAAAAGCCCTCGCTCTCGCCTCTAGGGATTCTCTCGCTG
CATCAACCGTTGATTTCTGGAGCTCGCCCACCCATCTAAGCCATCACCAA
AGCCATCACCACTGGAATACCTCCACAATCACACCCTCACACAGAACCCC
AATAGTATCCACCACATAGATCCAGAAAAAGCCCCTTACCCGAACCACAA
ACTCCACCATAAACGCAACCACTGCAGCTTCCTCTCCCCCCCCCCTCCCC
TCCTCCCACACAAGACTGCTTCGACAAAACCCGGCCGCGCTGCCAATACC
TCTTTCACCTTTACAGCACCCATCACTACTACCATTGCTTGCTGCAGCCA
CCACCGCAGCAGCAGCGACTTTTTTCGTAATAATACCATCACGACACTCC
TCCATCCATTCTCATTTTTCTCGATCCTCAGTCTTCTCACTTTATAGCCT
TTCGGGTGGTAGCTACAATACGACTCTGAGAAGGTCGAGGTCTACTTCCA
CCGAGTCGTTGCTCGACTCGAACGAACAAAGTCTGGCTAAACTTTCAAAG
GTGATCCTACGCGGCGACGGATCTACCTATAACGAAATCTCCAATCCTAA
AAACAGCAAAATGCATCAAACAAGTTCGCGATTACTGCGGATGACTGCGG
ATGACCGTCCGTACACTAGGGATTTCAAGGATCTTTTCTCTACCCTGATG
GTTAGTTTGCCGTTATCTTCTCACAGGATACGTTTCAAGACATACCCCTT
CAGCTTTGCCTCTGAGGAGGCAATCAACAATCTTGGTTCGTTGAAGTTTT
CTCAATCGAACCGAATGCCCGATCCGAAGGATCACACTCGGATCGTCACC
ACGACAACCACAACCACTTTTTCGATGGCTAAGGAAATGGCTCGCTCTGT
TTGTCAGCGATTTATGGATGCTCGATTTATTGAGCTGGCTGACGGAAAAT
CTACCATTTATTTCCCCCCAAAGGGATCTTTATGGCAATTGACGCCCAAA
GGGATTCATGTTTTGGAGAGGTTCTGTCAGCGTAATGGCATCCAACAAGA
CCATGTAATAAAGTTATTACAGTCTTCATTCAACACCATGCGTTTGGTTA
TTTTGGAGAGGGATTCAGTAACGGATAGGCTGTCCCATGACAAGACCACG
ACTGAGGTTATCTTTAGGCGGTTTGCTGGAGCAACTCCTAACATCAAAGC
TAATGTTTCCATCTCCGATTCGGACTCTGTATCGGAGTATCATGATGGCG
TTACGGGCGTCAAGCTTGCTGAGACCCGTAAAGTTGGTGACAGGGTTGTT
AAGAGCTCGTTCACTGGGAAATGTGCGGTGGATTGGTTGCTCGATTGTTG
TACGACGGTAGAGAGGAGTGAGACTCATGAAATTCTCAACCTGTTCATAC
AATATGGATTGGTCCAGTCTGCTTTTGAGGATAAGGCCTACATTCAGGCT
AACCCAAAGGCAAAAGATTTTCAACCGACCAAAAATGCCATCTACATTTT
CACCGACAAAGGGAAGAGAGTGTCGGGATGGATTGATGGCGACCGGTTGA
GTCTGCAGAATGGAGATAGGGGAAGTGACGGAAACTCCGTACGAGGCACA
TCCAAAGGTAGGAACCGGGAGGAAGGGTTCCCTAGAGATCAACGTGAGAC
TAACACTACCCGGCTGACCGCTATCCTTAACGACGCTGCTTTGAGGTTGT
TGTTCCGCGAATACCTTCGGGAAACTGTATGCGAGGAAAATCTGTCATTC
TGGCTGGATGTTGAGGATTTCAATCACAATTTCCTTGCAATTGATAAGTC
GAAACCTGATGCTGTGCGAGAAACCTTAGCGGCTGCCTATGGCCTTTACA
ACGCATTCCTTGCCCCTGGATCCCCATGCGAATTAAATATCGATCACACG
CTTCGACAAGACATGGCCTCTCGAATGACCCGAGCTGTTGCAAAGGACGA
AAATGCAATGTACTCCAGTTTGAAGGAGGTGGCCGCTCTTTTTGACCGAG
CGCAACAACAAGTGTTCAAACTCATGGCAGGAGATTCTGTTCCCAAATTT
ATCCGTACGCAGAAGTATATCGAGGTCGCCGGCGATATTCTTGAGGATGA
GAGGAACGGTCATTCGGGTATCGAGAGAAGCCTGAGCCGGAGATATAACA
ACGGAACCGCATCATAGACGGGGCTGTTTTTCATATAAATTGGATATCTA
GACCATCCTTTATTATGGGATTGGTTTAGTGCTTAATATCATTTTTTCGC
TTCGACTACTTTAGGCCGCTGGAGTTTTACTTCTTTTTCAATCTCTCCAG
GGATTTTAGGGTCTTTTCAGGAGTTTTTGGGTCATCAACATCATTGGTTA
TCGTGGTTCTCTTTTTCTTAGCCACCCCTTTGCTTGCTGGAATTTGTCGA
CTGTCCGCTGCTATTCGTCGCTACAGAGTGACGATCTATCTTGTCTCACA
GCGCCTTAAAGGCCCTTTATGCATCTTTGTTTATTTTTCTTTTGCCCTTT
AAATCGTTTTTATTCCCAGCTTCCTTCTCTTTGTCTCGTTATTCTACGGG
TGAGCTTTGGAGGGTGCTGTGTCCAGTATTTATGCATATCATACATAAGG
TACAGCCTCTTTGTATAGTTTATTTTCCCCTCTCGGTTTCTTTTTGTTTA
TCGAAAGATTGATGGGTTGATCATGAGGTGACGAACTGATTGGGAGAGGG
CTGGTGGTAGTGGGGAGTATTTTATATTTTTCTATCTCTTGATGTCAAAA
TTTTAAAATAGGGAAGGCTTTAATATAGAGGTTTTTTTTTTTTTTTCCTT
TTAACTGATATCTCTTTTCTCAAGCTACCTTTTTTCTTCTTCCCTCTTGT
CTTCCTCTTGGACATTTTTTCCCCTCCTTCCAATATCCCTCTTTGTAACT
TATGTTTGTTGAATTGGGGGCGGCGGGAGAGCTGTAATTGAACCACATTT
AATTGTAGCCTTC

Sequences in the Contig:

SY0AAA10YJ12FM1 SY0AAA17YO20FM1 SY0AAA18YE13RM1
SY0AAA18YO16FM1 SY0AAA1YN02FM1 SY0AAA22YL20FM1
SY0AAA26YC05FM1 SY0AAA28YE20FM1 SY0AAA31YM11FM1
SY0AAA36YA11FM1 SY0AAA38YF09FM1 SY0AAA4YP04FM1
SY0AAA53YJ02FM1 SY0AAA55YC08FM1 SY0AAA57YN20FM1
SY0AAA5YI15FM1 SY0AAA9YC19FM1 SY0AAB1YA07FM1
SY0AAB20YB18FM1 SY0AAB20YN14FM1 SY0AAB29YG01FM1
SY0AAB29YG18FM1 SY0AAB30YD01FM1 SY0AAB35YB22FM1
SY0AAB35YE13FM1 SY0AAB36YB16FM1 SY0AAB48YB15FM1
SY0AAB51YM24FM1 SY0AAB56YL24FM1 SY0AAB59YJ07FM1
SY0AAB60YA18FM1 SY0AAC13YC24FM1 SY0AAC14YE12FM1
SY0AAC14YP14FM1 SY0AAC31YE24FM1 SY0AAC39YI10FM1
SY0AAC39YI12FM1 SY0AAC42YO18FM1 SY0AAC49YJ12FM1
SY0AAC55YN20FM2 SY0AAC59YH18FM1 SY0AAC60YF07FM1
SY0AAC6YE19FM1 SY0AAC8YB09FM1 SY0AAD16YF04FM1
SY0AAD17YB07FM1 SY0AAD22YL10FM1 SY0AAD22YP20FM1
SY0AAD25YF07FM1 SY0AAD32YF20FM1 SY0AAD33YF08FM1
SY0AAD33YJ12FM1 SY0AAD39YA18FM1 SY0AAD3YN20FM1
SY0AAD42YM18FM1 SY0AAD45YK23FM1 SY0AAD49YI13FM1
SY0AAD49YP06FM1 SY0AAD4YL16FM1 SY0AAD53YG19FM1
SY0AAD55YL15FM1 SY0AAD56YP02FM1 SY0AAD57YH11FM1
SY0AAD62YM18FM1 SY0AAD62YO20FM1 SY0AAD8YF09FM1