Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1431
Length(NT) : 1363
Best Gene Model Blast : Link to GSTUMT00007783001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein CHGG_01008
Accession: ref|XP_001220229.1| Score: 425 E_value: 1e-39
KEGG Definition: hypothetical protein
Accession: fgr:FG09130.1 Score: 388 E_value: 9e-36
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1431
TTGGAACTCGGAGAGACACCCCTACATCTCGCTGTCAAATATAAACGTCA
GGCCAATCCAGACTGGCAGCTTAAGTTGACTTCACAACTTATCGATGCCT
GTCCTGAATTGCTGAAAATTGTCAACAAAAATAGCCGATCACCTTACCAA
TACCGGCTCGATACTCTGAGGGCGATTGAAACGAATACGAGTTCCAATAA
CGACGACATAGCAAGATTTATGAGAAACTGCTATATGCACTTTGAGGACC
GTGGCGAGGCAGTTAAGTATTTGTATGGAAAGGAAGATGAAGAACTTTCG
ATGGAGATTGACCTTTCTGAGCATTCTATCTACACATTCTCACGTGACTC
TCTTACAAGCCTCAGCCAGCACTGGAAGTTTGAAAACATTCTCCGATATG
TCTATTTTCCAAAGGTCAATTTCAAGAATTCTTCAACAGATAGCTATCCT
GTAAAGGATATCTCGAAAAAACAGGGTCAGAGCCAACACTACAACTCTAA
TGATGAAGGTATTGGACGCAAAGACCTGCAAGCCATGTTCGATTGGCTAC
GAAATAATCGTGGGGTAAAAAAAATTATCAAAGTCCGAGTCATAGACAAC
GAGGACCCGCCACACAGTGACGAAATCATCGAAGAATCTCTTAAAAATTT
TGATGTTGAAGTTTTAGATTGGTTCAAGTTTGACCTCTGCAGCGAAACAA
TTCTCAAGGCAGCCCCAGATGTGCAAGAAGTGCACCTATACTCAAGCGGA
AACAACGCCGTTCTTCATGCCTGGTCCGGCTGCGATGGGCTCAAGAAGCT
CAGTAAGTTGAAAAAAGTCTATATAGATATATACCAGCGGCTGGAGACAT
ACCACAGAACCCAAACGATTCTTGACGCCTTCAAAGATAGGCTCAAGGCT
CATATTGATGGCATAGTGATTGAGGAGAGGATAGAAAAATATTCTGCCTC
TAGGGGTAATGGACTGGCAGGCACAAATAGTGTAGTAGAAGGTGGTTCCG
CACAGCAAACACATACATGGATAAAACATATGGATACTTTTGTTAATTTC
ATAGTCAACATTCCTGCCGATAAAGAAAGGAAAATCAGGGTAGCCTTGAT
TGATAATGGTGTGGACGGATCATATTCGCGATTAGGTCAAATAATTAAGC
TTGGTACATCTTATTGCAGCCATCCACACCACCAGGGTCAACTCAACAAC
TATTGCACACCGTCAAAAAGCCATGGAACACAAATGGCAAGCCTTATCAG
CCAAGTTTGCCCCAAAATCGATTTGTATGTTGCAAGAATCTTGGATATGG
AGGCAGAGGATAGTAGACAAATAGATGTGGGATCAGTTGTAAAAGCGATC
AATTGGGCTGTCG

Sequences in the Contig:

SY0AAA4YO23FM1 SY0AAB26YG11FM1 SY0AAB38YB18FM1
SY0AAB53YE02FM1