Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1430
Length(NT) : 1986
Best Gene Model Blast : Link to GSTUMT00006942001 E-value : 0.0
Numbers of ESTs : 30

Blast Results:

Nr Definition: hypothetical protein HCAG_09029
Accession: ref|XP_001536078.1| Score: 1254 E_value: 1e-135
KEGG Definition: hypothetical protein
Accession: ang:An11g02770 Score: 1254 E_value: 1e-136
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG1843 Score: 938 E_value: 1e-101
PFAM Definition: DUF500, Family of unknown function (DUF500). Proteins in this family often also contain an SH3 domain (pfam00018), or a FYVE zinc finger (pfam01363)..
Pfam Number: pfam04366 Score: 436 E_value: 2e-43
Swissprot: Q9URW6|YIE2_SCHPO

Sequence:
>Contig1430
TTGGGCTTCACGTGAGGGCGTCGTCGTCATCCTTTTTTGGTCATCCTTTT
TTGGCCCTCCTTCCCTCCTCCTATTCTTCCTCCTGCTACGGTGCTCTTAT
CGTACGAGGTTCGTTCTGCTACCCCGCTACCTACTCCGTCCCCACTCCGT
CCCGCTACCCTTCCCCGCCTCTCTCCCCTTTGTTGTAGACAGTGCATCTG
CTTTATCCGCATCGTAGTTCTCCTGTTCACGAATCCTATCCAATCAACAA
ACTTGTTCCTGTCTACTGACCAACCCGCAGCCGAGAGTGTTTGTTTGAAA
AGCTATGGGAATCAACAACCCTCTCCCAGCAAGTCTACGCAGCGAGTGTC
GTAAAGCCTCCAGGATCTTGGCTTCGTTTGTTGATCCCAAACAGAGCTTT
GGGCCTGATAAGATTATCCCGCCTTCTGTTCTTTCTAATGCTAAGGGGTT
GGCGATTATCACGGTGCTTAAAGCGGGTTTCTTATTCTCGGGGAGAGTCG
GATCCGGATTGGTGGTTGCGAGAAAGGGTGATGGGTCTTGGTCTGCTCCG
TCCGCAATCGCTACGGCTGGCGCCGGGTTTGGAGGCCAAATTGGTGCTGA
ATTGACCGACTTTGTCATGATCCTAAATGACTCGAACGCTGTCAAGACTT
TCGCTCAGGTTGGTAGCATCACGCTTGGAGGAAACGTATCCGTAGCTGCA
GGTCCCGTAGGAAGAAATGCGGAAGCTAGCGGTGCAGCAAGTTTAAGATC
TATAGCCGGGATCTTTTCCTATAGTAAAACCAAGGGCCTTTTCGCCGGCG
TCTCGTTAGAGGGTTCAGTGATTGTGGAACGAAAGGATGCCAACAAGAAG
TTTTATGGGGGGAACGTCTCTGCTAAGCAGCTGCTCAGCGGCAGCATTGG
CCCACCACATGACGCGGACGCACTCATTCGGATTCTGAACTCCCGTGTAT
TCTCTGGAAACCTTACTGGTATGAACTATGACGATATGTATAATGATATT
CCTACCTACGACAGTGATAAAGACGAGTCTATTTGGGAGGGTCAGAGCGG
CAATGCTTATGGTGAAGGGACGAGACGGGGCTCAATAGGGAATCGCAACT
TGTCCAGGTCTTCTACTTGGAAGGACGATCGGGATAGTGGTTCTCCGCGT
GTGGTTTCTAGGGCGTCTACATGGCAGGACGATGTGTACGATCGGGATAG
AGATAGGGGCAGAGATGATCCTGCTGATTCCGCATGGAGAGCGTCGCACC
GTCCGGACCCTGCTCAGACGTTCGACAAATATGAGAGTTCCAAGAGCACT
CAATTCCAGAGGCAGCATTTCAACAGCACCTACTCTGATAAATCACCTTC
ACCCAAGCGGCCCACAGGGCCCAAACCGGTCTTCAAACCGAAGCCACTGT
TCACCAATAAGGCCGAACTAAATGCCAACCAAGCTATTGCGCTATACACC
TTTGAGGCGGATCAACCAGGCGATTTGGGTTTCAAAAAAGGTGATATCAT
CACCATCGTAAAGAAGACCGATTCAAAAAACGACTGGTGGACTGGAGAGA
TCAATGGTAAAACAGGAATATTCCCTAGCAATTATGTTGAGACCATGTGA
TGTTCTCGATTGGGTTGAGGAACGAGAGACGTGGTGGCGAGGAGAAAAGG
TAGTTTTTTTTTTTCTTTTCAAAAAAAGAAATTTGATTTCAGCCTAGTTA
CGACTTTCCTACAGTATGGTACCTCTACTCTGTTCTGGTGAATGTTGGCT
GTGTGAGTGAGTGTGGTAGACATTGGCAATTTGGTGTTTGGTTTTGCTTT
CTCCCTTTTCCTGTCGATTTTAAATGGGTATTGGTTGTTCTCTTCTCTTA
CATCTTATTCCATCGCAAGCGAAATTGTTTTTCATGTTCTACATCTTATT
GTGCATGTTCGAGTTACATGGTTAGTCTAGTCAGTGCACTTGTGCGTGCC
AACGAATCCAGTCTGCCCCAGCAGCACTTTTCCCAA

Sequences in the Contig:

SY0AAA11YD21FM1 SY0AAA32YB13FM1 SY0AAA36YA21FM1
SY0AAA3YB16FM1 SY0AAA4YO22FM1 SY0AAB15YE06FM1
SY0AAB21YE19FM1 SY0AAC21YA21FM1 SY0AAC21YC21FM1
SY0AAC32YF05RM1 SY0AAC32YL11FM1 SY0AAC33YE17FM1
SY0AAC40YA05FM1 SY0AAC41YE08FM1 SY0AAC45YC01FM1
SY0AAC52YE09FM1 SY0AAC53YN22FM1 SY0AAC54YP11FM1
SY0AAC55YN23FM2 SY0AAC58YE03FM1 SY0AAC9YC10FM1
SY0AAD13YB03FM1 SY0AAD2YG03FM1 SY0AAD36YA23FM1
SY0AAD36YO19FM1 SY0AAD5YD06FM1 SY0AAD63YL01FM1
SY0AAD6YH15FM1 SY0AAD6YM20FM1 SY0AAD9YB01FM1