Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig143
Length(NT) : 894
Best Gene Model Blast : Link to GSTUMT00008458001 E-value : 1e-170
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein Bm1_17870
Accession: gb|EDP36122.1| Score: 188 E_value: 2e-12
KEGG Definition: conserved hypothetical protein
Accession: fgr:FG01410.1 Score: 147 E_value: 4e-08
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG0162 Score: 115 E_value: 1e-06
PFAM Definition: SH3_1, SH3 domain. SH3 (Src homology 3) domains are often indicative of a protein involved in signal transduction related to cytoskeletal organisation. First described in the Src cytoplasmic tyrosine kinase. The structure is a partly opened beta barrel..
Pfam Number: pfam00018 Score: 113 E_value: 2e-06

Sequence:
>Contig143
TTGGGATGGTAGGATAGTGGCCTACCATGGTTTCAACGGGTAACGGGGAA
TTAGGGTTCTATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAA
GGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGACACGGGGAGGTAGTG
ACAATAAATACTGAAAACGAGCTCTCACTTTCGAAAGATGAAGTAGTTAT
AATTATTCGTAAGGAGGCGAATGGGTGGTGGCTTACTAAGAAAATGAATT
CTACTGAACAAGGTTGGGCACCGTCGGCATACCTTGAAGAAGAGGCTGCT
CCTCCCCCTACCCCACCGCCACCACCTGTTGCCCCTGCTCGACCGGCAAA
TGGGGCGGCTAGACCAGCAGGTAGGAAACCGGCACCACCAGCCCCTCCGG
CAAAGAGGCCAACTGTTGGGAGAAAGCCTGCAACGGTGGAGAACAGAAGC
AGTGTCGCGGGTAGTACTAGTAGTAGTAGTAGTGGGGCCGGAAGCTCTAC
GACAAGCTTTGCACCTGGTTTAGCACAGGCCTTACTAGATAGACAGCAAG
CCATGAGAGGAGGGAGGAAGGATGAGTCTGACGATTGGTAGATTTTCTTG
AATAAACTATTTTTCGCGTTCCTCTCTTGCTTTGAAGTTTTGTAGTGAGC
AGTTGCACCAAATTTCACAACACCCCGGTTATTTTTTTCTTGGTTCCATT
TTCATTTCCCATTTTCCTTTTCTCCGCCACAATAAATAGAAGAGAGTCGG
CTTTTGTTATACGGGTAGTGTAGACTTGGGGTCGTGTTTTTATACTATAC
TTTTTTTCTTCGTTCTTGACCCCATCCACCCAGTTCTTCATCGGCTCGGT
GCCGAGAGGGAGGGGGGAGGGGGGCATTTTCTGTGTTTCTATTG

Sequences in the Contig:

SY0AAA15YD18FM1 SY0AAB33YN24FM1