Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1429
Length(NT) : 2367
Best Gene Model Blast : Link to GSTUMT00009095001 E-value : 0.0
Numbers of ESTs : 92

Blast Results:

Nr Definition: hypothetical protein SS1G_08270
Accession: ref|XP_001590530.1| Score: 493 E_value: 6e-51
KEGG Definition: hypothetical protein
Accession: ang:An14g00600 Score: 505 E_value: 5e-49
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1429
TTGGGCAGCAATAAGTGGGAAGGCCTACCCCTCACACTCTCCCAAAAATA
AAGTCGTACTTGCAAGTCGGAAGTCCTCATAATAAACAGGAGACCTGCTC
ACCTTCTTGCTCCCCTCCCCACTGCCGGTATATGCCCGAATGATCGATTC
CTGTTAATTCCCTTCCACCCATCTCTACCAACCGTCGGAAACAGTCTGGT
GTGGTATTATCCTACGACTCGAGTAGTGGCGTGTCAAAAAGAAATAGGGG
GAGAAAAGCGCATTCGATCATCTACCGGTATCTATCCAGTGAATGACACC
TTCGAAATACGAGGAAGGAGAAGAAAATTTGGTTTCCATGACATCTAACC
TGCCATAATATCGGCCACTTTCGCTCTGTCTTCTAATTTGTTTGCCCAAA
TTTTTTTTCCACCTGCAGTTTTTATTCCTGTTTTTTCCGGTTATTTTGAG
CACGACCGTTCCGGTTCACTTTCGTACATTATTGTGCAACGCCCCTTTGC
CACCCAGGTCGGTATATTATTCACAGGCTCTGCAGTACTACAGACTGCTT
TCCTTAGTTCCTTTCACGAACCTCCCCAATACTATCATCGTTCCACCAAT
ATGAGTTTATCAGGTCCTTCACATTTTCAGCACAGAGCATCGGACGATAG
CGATAGCAGTATGGGCACCTCCAGCGACAGCAGTGCATCACGAAGTACTG
TACCGAGTTCACTGCCATCGTTAGAGCAACATGAATCAAAGACGGCTTCT
CCTGCAGAATCGGAGATCTTTGATTACCACCCTGCCCATGACCCCCGCGA
GTCGGAAAACACGTACTGCAGCACGGTCGAAGATCCAGACGATGATTACC
CCTATTACGATACCCATCCATATGTACACTATCACAAGGCGCCACCACCA
CAGGCCTCGCCTTCGACCCCCTCAGAGTTTGCCGAACTCTTTCCATCAAC
CAGGTGCCTTTCCATACGGCATGATGATTCAACGCTTGACGGGAACATGA
ACTTGAGGGTGGACACGAATGTGGCTGCTGTTGGTGATGTTGGAAAGAAT
GTTACACTCTTTCATCTTCGGATGTATGATTTGAGGACGCGCGACTTTTC
TCTTCGACGATATGGTCGGGATTGTGGGCGCGAGGTGGCTCACATTAAGC
GAAAGACAATCAAACCCGCACCCCAGCGACCCAGACTTCAACGCTCTGTC
AGTAAGGCCTTGCATAGCTTTCGTGGAAGGACGGAGGCGGAGCCAGTAGC
AAAGTTGAACCGTCAGGATAGTGGATATTCATCTTCAGGTTTTGACGGGG
AAGAGGAGGAAGAGCTGAAATCCTCGAGCGAGGTCACCCAAAACAACAAC
ATTTGCACGTTAGAGTTCTCTAATTATGCCCATGTTGATTTGACCAGGCG
TGGAGGAAAGGGCTCGAAAAAGTATGACTTTGAGTACTGGGGAAAGAGCT
ATTCATGGAAGAGGGTTGCCAAGCAAGTTGGGCCGCATGCTGGCGCCGAA
GAAATTTCGTATCAACTCGCCAACAACAGCACCGGAAATGTTGTTGCCCA
TATCGTGCCCGATCCACTTTCACCTACCCAAGCGCAAGCCGAGGAGGCCA
AAGGCGGAATTGTCCCTCCGTGTTCATTTTGGTTGAGGGATTCTAGTCAG
GATCCCATTATATTGTGCCTAGCTGACGTTGCCGAGTAAGTCTGATTCTG
GCCCATCCCACCGCACCTTACGAAAAAGAAAAAAGGAAACGAGAAAGTCG
AGGAAATGATAAGCATTTTTACCCCTTCAATTATCTAACATTATGTCTTT
CTTTAGCGTTATTATGGCCACTGGTTTGACGGCGCTCGTTGATGATTGCA
TCAAGCGCAGGTTTCACAAGAAAAAGACGGTCCAATTGGTATTACCTATG
CCAATGATCAAGAATCCCATGAAGATGAACCTGGAATATGTTGGGCCAAA
ACGTCTCATCGACGAGGTCTTCAACCGAAGGCCCACTCTGTCGAGAAGTC
AATCGACGCAGAGTAGTCGAAGTCCCCTTCCTGTTAGATCGGCGACCGCT
TAAGTCCGTCCGCTTTCCTTTTCCTCAATCAGTTCTTCGGTCGGGGAAGA
AATATATGAACAATAGCCGGCGTACATCTTTTATGGGGTGTTCTTCCTCT
CTCTCTTTCTTCTCAAGTACATAATATTTTGTGCATACCATTTATCATTC
CGTTTCGTTTTTTGGGAGGTCCGGCGTTTTTATTCTTCACTTTCGGCATC
AGAGCAGAGCGTCTACTATCTGGTAAGAAGTATTCTAGGGTCCGTTGTTG
GTTGGCTGGGTGTTTGGGTTATATCTCGCGTTATTAACTCCCCCCTCTAT
CTCTTTGCTCTCCCTCC

Sequences in the Contig:

SY0AAA12YI20FM1 SY0AAA23YM10FM1 SY0AAA27YB10FM1
SY0AAA2YK08FM1 SY0AAA32YH02FM1 SY0AAA39YI01FM1
SY0AAA3YO22FM1 SY0AAA40YE01FM1 SY0AAA42YC21FM1
SY0AAA46YP05FM1 SY0AAA46YP16FM1 SY0AAA4YO03FM1
SY0AAA50YC24FM1 SY0AAA52YA18FM1 SY0AAA54YB10FM1
SY0AAA54YO07FM1 SY0AAA55YC17FM1 SY0AAA61YI12FM1
SY0AAA62YK13FM1 SY0AAA8YK04FM1 SY0AAB22YF05FM1
SY0AAB26YH23FM1 SY0AAB27YH24FM1 SY0AAB32YG15FM1
SY0AAB36YH02FM1 SY0AAB38YJ24FM1 SY0AAB39YB10FM1
SY0AAB39YF01FM1 SY0AAB39YF20FM1 SY0AAB47YA19FM1
SY0AAB50YI09FM1 SY0AAB51YH19FM1 SY0AAB52YJ19FM1
SY0AAB7YD06FM1 SY0AAC10YI19FM1 SY0AAC15YE07FM1
SY0AAC16YM11FM1 SY0AAC18YM13FM1 SY0AAC18YN15FM1
SY0AAC19YH06FM1 SY0AAC23YG03FM1 SY0AAC24YF13FM1
SY0AAC27YK21FM1 SY0AAC28YL11FM1 SY0AAC31YF03FM1
SY0AAC31YG17FM1 SY0AAC31YN08FM1 SY0AAC33YO20FM1
SY0AAC34YG02FM1 SY0AAC36YO15FM1 SY0AAC37YH18FM1
SY0AAC39YG02FM1 SY0AAC39YJ23FM1 SY0AAC39YM01FM1
SY0AAC42YF15FM1 SY0AAC43YB10FM1 SY0AAC44YH12FM1
SY0AAC48YI17FM1 SY0AAC49YE01FM1 SY0AAC49YM16FM1
SY0AAC54YC16FM1 SY0AAC55YG11FM3 SY0AAC55YP03FM2
SY0AAC58YL22FM1 SY0AAC59YJ24FM1 SY0AAC61YI09FM1
SY0AAC7YF22FM1 SY0AAC7YK05FM1 SY0AAC8YM20FM1
SY0AAD11YB12FM1 SY0AAD11YG24FM1 SY0AAD11YH24FM1
SY0AAD11YO04FM1 SY0AAD13YB23FM1 SY0AAD1YL05FM1
SY0AAD26YE17FM1 SY0AAD26YJ18FM1 SY0AAD27YB09FM1
SY0AAD27YD01FM1 SY0AAD29YO01FM1 SY0AAD30YF07FM1
SY0AAD31YP19FM1 SY0AAD32YA18FM1 SY0AAD34YM24FM1
SY0AAD42YJ17FM1 SY0AAD55YG22FM1 SY0AAD58YI11FM1
SY0AAD5YC12FM1 SY0AAD60YA05FM1 SY0AAD60YH18FM1
SY0AAD60YH22FM1 SY0AAD9YB19FM1