Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1428
Length(NT) : 3028
Best Gene Model Blast : Link to GSTUMT00009912001 E-value : 0.0
Numbers of ESTs : 17

Blast Results:

Nr Definition: hypothetical protein SS1G_04388
Accession: ref|XP_001594581.1| Score: 2779 E_value: 0.0
KEGG Definition: puromycin-sensitive aminopeptidase and related aminopeptidases [EC:3.4.11.-]; K01269 aminopeptidase
Accession: aor:AO090023000645 Score: 2760 E_value: 0.0
KOG Definition:
Classification: [Amino acid transport and metabolism, Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1046 Score: 2018 E_value: 0.0
PFAM Definition: Peptidase_M1, Peptidase family M1. Members of this family are aminopeptidases. The members differ widely in specificity, hydrolysing acidic, basic or neutral N-terminal residues. This family includes leukotriene-A4 hydrolase, this enzyme also has an aminopeptidase activity..
Pfam Number: pfam01433 Score: 1132 E_value: 1e-124
Swissprot: P32454|APE2_YEAST
Gene Ontology:
GO:0030287 = Cellular component: cell wall-bounded periplasmic space
GO:0005739 = Cellular component: mitochondrion
GO:0004178 = Molecular function: leucyl aminopeptidase activity
GO:0006518 = Biological process: peptide metabolic process

Sequence:
>Contig1428
TTGGCCTTTCCCCGCTTCAGACCTGGAGTTGCCTTCCTTCGCTTTCCGTG
CCGCCCCCTTTCGCCTTCTCAGCTAAATGAGAGCTTTCCTGCGTGCTGTC
CCGGTCACACGATCTAGTCTCCCGCACCCCCGCTCTATAAGTCGGCTGAG
AAACTACAGCTCCATCTCTCAACATCGTTCATCTGCTGCTACTACTACGA
CTGCTGCTACTGCTACTGATACTTCATCTTCACCTTTACAAAGTCGACAT
AGACTCGTTGCATCTTCGTTAACTTCTCGCCAGTTCGTCCGACGCTGTTC
TGCTCACAGAATGTGTTGCGGTAATGATTCTTCTGGCTCGGTCGATATCA
CTCAGGGGAGGGAAGTCTTGCCGGGGAATGTGAAGCCAACCCATTACGCC
GTTGAGCTCGAGCCGAGCTTTGAGACGTTCAAATATGACGGGACTGTTAC
AATTGATTTGGCGGTAGTGAAGAATAGTACTACTGTTGCTGTCAACCTTA
TCGATATTGATATTAAGGAGGTCTCTTTGGAATACAATGGAAGCTCTCAC
AGTCCTACCGATTCCAGCCATGACGAGGAAACCCAAACTATTACTTGGAC
TTTCGAGGAGACTATTCCTGAGGATACCCAGGCTAGCCTTACCATCAAGT
TCCAAGGATTTCTCAATGATAACATGGCTGGTTTCTACCGTTCATCCTAT
AAGGATGAGGAAGGAAACATCAAGTATATGGCTACTACCCAGATGGAGCC
TACCGATGCTCGGAGGGCTCTCCCTTGTTTCGACCAACCGGATCTCAAAG
CTACCTGGGATGTCACCTTGATTTGTGACAAGAACCTAACCGCCCTATCA
AACATGGACGTCAAGGAGGAGAAGGAACTCGACAATGGAAAGAAATCCGT
TTCCTTCAACAGAAGCCCCAAGATGTCCACCTACCTTCTCGCATTCATCG
TCGGAGATCTGCGGTTCGTCGAGAACAACGACTTCCGGGTCCCCATTCGA
GTTTACGCTACACCAGGTTCGGAACATCATGGACTTTTCTCGGCAGAGCT
CGCAGCAAAGACTCTCGAATTTTACGACAAAACCTTCGATTACCCATACC
CGTTACCAAAGATGGACATGGTTGCCATTCCCGACTTTTCGGCGGGTGCC
ATGGAGAACTGGGGTTTGGTCACATACCGAGTCGTCGACTTGCTCTATGA
CGAGAAGACCGCTGCGTTGGACCGAAAGCAGAGAATTGCCGAGGTCGTGC
AGCATGAGCTTGCTCACCAATGGTTCGGAAACTTGGTCACTATGGACTTC
TGGGAAGGACTGTGGCTCAATGAGGGTTTTGCTACCTGGATGAGTTGGTA
CTCTGGGAATAAGTTTTACCCCCAGTGGAAGGTTTGGGAATCATATGTTA
CCGACAGTTACGCGGGGGCTCTGGGATTGGATGGATTGAGGAGTAGTCAT
CCCATTGAGGTGCCGGTAAAGAAGGTTTCCGAGATTAACCAAATTTTCGA
TAGTATTTCTTATTTGAAGGGAAGTTCTATATTGAGGATGATTTCGGTCT
ACCTTGGTGAGGACGTTTTCCTAGAAGGTGTTAGAAGGTACTTGCGGAAG
CATGCATATGGAAATACCCAGACTGGTGATTTGTGGGCAGCTCTCAGTGA
TGCTAGCGGAAAACATGTCGAGAGCGATATGGCGACTTGGACCAAGAAGA
TTGGCTACCCCGTCATTACTGTCGAGGAGCAGGGTAGCAAGCTTCACTTG
ACCCAAAACCGCTACCTCAGAACCGCAGATGTCAAGCCCGAGGAAGACGA
GACACTATGGCCCATCTTCTTGGGTCTCCGCACTAAGAGCGGCATCGCCG
ATAATCTTACCTTCAAGACTAGGGATACCACGATCGAGCTTGACGACCCG
GAATTCTACAAGCTCAATGCCAATCATACCGGTGTCTACCGTACTCTGTA
CCCTCCAGAACGCCTTGCGAAGCTTGGCCAGGCTGCCGACCTTCTTTCTG
TAGAGGATCGCGCAGGTTTACTCGGGGATGCCGGAGCCCTTGCTACGAGC
GGATACCAGAAGACTTCCGGCCTATTGGATCTCCTTGTTGGCCTCAAGAA
CGAGAAGGAGTACATTGTCTGGTCCGAGGTTGCCTCTAGAATTGGTAACA
TCAAGGCTGCCTGGCTTTTCGAGCCCAAGGAAGTCTTCAAAGGATTCAGG
GGGCTCCAGAAAGACCTCTTTGCACCAATTGCCCACGAAATCGGCTGGGA
TTTCAAGCCTGAGGACAGCGATATCCTCCAACAGCTCAAAGCGTTGACTT
TTGGTCAGGCCGGATATGGCGGTGACGAGGAGGTCGTTGCTGCCGCGAAG
GAGATGTTCAAGAAATTTGCTGATGGTGATGTTGATGCTATTAACCCCAA
CATCCGCACTCCAGTTTACCATATCGTATTGCAGCATGGTGACAATGATG
GCGAGAAGGAGTGGGACATAATCCACAACGTATATCTGAATGGCCGTACT
AGCGATCAGCGCAATGGAGCCCTCCGCGCCCTTGGCCGCTCCGAGAACGC
AGAAAATATTCAAAAGACCCTTGATATCTGTCTCAATGGCGAAGTCAAGG
AGCAAGACATCTACCAACCGATTAGCGGTCTCCGCGCCCATGCCGCTGGC
ACGGAGGCTCTTTGGGCCTGGACACAAAAGAATTGGGACACCCTCGTCAA
GAAGCTTCCACCTGGCCTCTCCATGCTCGGAGGCGTCGTCAGCACCTGCA
CAGGAGGCTTCACTTCCGAGGAGTCCATCGCAAATATCGAGAAGTTCTTC
GAGGACAAGAGTCAGAAGGGATTTGATAGGAGCTTGGCTCAGAGTCTGGA
CGGAATCCGTGCTAAGGCTGCTTGGGTCAAGAGGGACGCTGATGATGTCA
AGGCTTGGTTGAAGGCGAAGGGGTACACGTCTGCAGAGAAGTTGTAGGTT
TATCTGAGTGCCGTGCCTCTTTTATTTTTCGGTGGCATCTAGAGTAGCTT
TTTAGAGTGAATATAGATGGTTTAGCGG

Sequences in the Contig:

SY0AAA15YO05FM1 SY0AAA26YK20FM1 SY0AAA44YK22FM1
SY0AAA47YK22FM1 SY0AAA4YN11FM1 SY0AAA60YH09FM1
SY0AAA63YO08FM1 SY0AAB37YA07FM1 SY0AAB45YN24FM1
SY0AAB52YO20FM1 SY0AAB5YJ08FM1 SY0AAC1YJ19FM1
SY0AAC28YC24FM1 SY0AAC28YC24RM1 SY0AAC48YP16FM1
SY0AAD51YG11FM1 SY0AAD56YA16FM1