Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1427
Length(NT) : 1165
Best Gene Model Blast : Link to GSTUMT00001596001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: UPF0052 domain protein
Accession: ref|XP_001274553.1| Score: 857 E_value: 6e-90
KEGG Definition: predicted protein
Accession: aor:AO090120000392 Score: 830 E_value: 4e-87
KOG Definition: No Hit Found
PFAM Definition: UPF0052, Uncharacterised protein family UPF0052..
Pfam Number: pfam01933 Score: 222 E_value: 6e-19
Swissprot: P53980|YNB1_YEAST

Sequence:
>Contig1427
TTGGCGTACACGCCCCAAAATACCCTTATTCTCTCATACTGGTATGATAA
AATAAGATAAAAAGGGGGGTGTAGACTATAAAGCATCATTCCCCATCCAG
CCACTCCCGCTCCCTTTCCTTTCCAAGCAGACGAAGGCGCAAAAATGTCC
ACCACCCTACGCAAGAACCGTATCGTAGTCTTCAGCGGCGGCAGCGCAGC
AAACAACCTTATAGACGTCTTCAGGCACCTTTGTAAAGACTCACGCCCTC
TGGATTTTATCCTTCCCATATCCGATAACGGTGGCAGCACGTCTGAGATA
TTGCGGGTGTGCGGGGGGCCGGGAATTGGTGATGTTCGGAGTCGTCTGAT
AAGACTCGTTCCGGAAGATACGGATGGAGAGCGCGGCGCTATCCGGAACC
TCCTGAATTACAGACTGCCCGCTGATCCCGGTGGGGCGCGATTGGAATGG
TACGGGATTGTAGAGGGGACGCACGCTCTTTGGGAGGGGATCCCCTCCGA
AAAACGCGAACTCCTCCGCTCCTTCTTCAACCATCTAAACCTCGAACTCC
TAAAGCGCCAACGCCCAACAGCCCACTTCAACTTCCACAGCGCCTCAACG
GGAAACCTGTTCTTGACTGGCGCCCGCTTCTTTACGGGCTCCTTCGAGTC
GGCGATATACCTCTTCCACTCGATAACCGGCGTACCATCAAACATCTGCG
TCATCCCGGCAATCAATTCTAACCACGCGCACCACATAGCTGCAGGTCTC
GCAGATGGGTCCGTTATTATCGGGCAGAACGAGATCTCGCACCCGAGCGC
TTCGTCTGCTTCGCTGCTCTCGCCGGAAGATACTCCTGCAGGGTCCGAGG
CGGGTGGCAGTGGTTCTGACAACGAGGGGGAAGAGGAAGGGGGGGATAAT
TTACCCGGATCGTTGGCGTCGCTGAGAAGTCAGAATATTGTGTTTTCAAA
GGGACACGAAGATAATGAGGAATTGTCGGATAGGATTGAGAGGATTTGGT
ATATAAATTTGTACGGGGAGGAGATAAGGCCTCCGGCGAACCCAAAGGTT
GTTAGTTCTTTGGGGTCAGCCGGGGCGGTGATCTACAGCATTGGGAGTTT
GTACACAAGTCTTATGCCTTGCCTTGTGCTCCGGAATATTGGTAAGGCAT
TGGCGGGGAGTGGGA

Sequences in the Contig:

SY0AAA4YN10FM1 SY0AAB58YF02FM1 SY0AAD51YH24FM1