Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1426
Length(NT) : 1057
Best Gene Model Blast : Link to GSTUMT00010539001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: dipeptidyl aminopeptidase
Accession: ref|XP_001547950.1| Score: 974 E_value: 1e-109
KEGG Definition: hypothetical protein
Accession: ncr:NCU02515.1 Score: 908 E_value: 1e-102
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG2100 Score: 715 E_value: 4e-76
PFAM Definition: Peptidase_S9, Prolyl oligopeptidase family..
Pfam Number: pfam00326 Score: 459 E_value: 2e-46
Swissprot: P18962|DAP2_YEAST
Gene Ontology:
GO:0000329 = Cellular component: membrane of vacuole with cell cycle-correlated morphology
GO:0016806 = Molecular function: dipeptidyl-peptidase and tripeptidyl-peptidase activity

Sequence:
>Contig1426
TTGGGGGGACAACTTTGTACAAAAAAGTTGGCACTGTCAACATTGATGGG
TTCGACCTCCATGTAGTGGAGAGACGCCCTCCCCACTTTAATAAAAAACG
AAAGTACCCTGTTCTATTTCAAGTCTACGGCGGACCTGGAAGTCAGCAGG
TATCCAAATCCTTCAGCATTGATTTCCAAGCATATATCGCTGCCGGCCTC
GAGTATATCGTTGTGACTGTTGATGGCCGGGGAACCGGTTTCATCGGGCG
CAAAGCAAGAGTGGCTGTCCGTGGCAATCTCGGATATTGGGAGGCTCACG
ACCAAATTGAGACCGCAAAGATCTGGGGGAAGAAGGGCTACGTTGACAAG
AAACGGATTGCGATCTGGGGGTGGAGTTATGGCGGGTTTATGACCTTAAA
GACGCTCGAGCAAGACGCTGGTAGGACGTTCTCCTACGGCATGGCTGTTG
CACCTGTTACAGATTGGAGGTTTTATGATTCCATCTATACAGAAAGATAC
ATGCACACCCCCCAGCACAACCAAGAAGGTTACCGTAATGCAACCATTTC
CGACACTCAAGCGCTCAGTAAGAGCGTGAGATTTCTGCTCATGCACGGGG
TAGCAGACGACAACGTGCACATGCAGAACTCACTTGCACTTTTGGATAAG
CTCGACCTAGCTAGTGTGGAGAACTATGATGTCCATGTATTCCCGGACTC
GGATCACTCGATATATTTCCGTATGTTTCTTGCCCTCCCCCCCTCCTCTT
TACGAGGTTTTGAATATGCGTTGATAGCTCAGTAGATAATGCTAACCGAA
TGGTATACGATCGCCTCGAGCAATGGCTCATACGTGCCTTCAATGGCGAA
TTCTTAAAGCTGGATGGGCTAAAGCCCATTAGGGAGATATCCGAGCCCCT
GCGTAAAAGGAACAGAGAGCTTGTTTGATTATGGGTCTCGTTTTTGCTCA
TTGAATTGCTTTTGTGTGTATGTCTGTTTAGTCTGGTTTCGCTTTCTGCC
AAGTTATCGTAGTTATGTACTATTAGTTTTGATATAGTAGGCGCCTAGGT
TTTTTTC

Sequences in the Contig:

SY0AAA13YG19FM1 SY0AAA4YN08FM1 SY0AAC21YM18RM1
SY0AAD4YB01FM1