Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1425
Length(NT) : 903
Best Gene Model Blast : Link to GSTUMT00003912001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001540065.1| Score: 406 E_value: 8e-38
KEGG Definition: hypothetical protein
Accession: ang:An18g05850 Score: 370 E_value: 6e-34
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q08977|YP260_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0005515 = Molecular function: protein binding

Sequence:
>Contig1425
TTGGACGTCCACGACATCCCTTTCCGAACCTCGTCGGAAAATCCGACGCT
TTTCGGAACAGCGCCCCACACTCTGTCCTCCTTGCCCTCATTCCCACACT
TCTCACCTACCGTACCAAGTTGCCAGCGGCTGGCGAACGAACTGACATCA
AACACCCCACCAACGAATACACCCCACCAAATTCCGCTCGCACTCCACTC
CACGTTTTGCGTCCAACCAACCATGAGCACAGCAGCAGCTCCCCCCACTT
CCATTGCCATTCTTGAAAAGCTGTCCGCGCTCAGGGAGGGCCTGATAGAG
CTGAAGCAGGACCGTACAACATACGTGAAATCACATGACGTCGTCAGGCA
CTACGATGAGCTCTGCGAAGGTATTTGGAAGATTTACGATGTCGAGGAAT
TCGAGAAGGGCTTTAATGCGAAGGAGGATTTATCGGAGGGGCAGATTATA
GAACGCGATTTGGCAGAAGATTGCTTTATGTTGATTTCACTGCTCTTCCT
CACCGTCGGGAGGAATAATGAGCCTCCAGCTGTTTATGCTCCAAGCGTGA
TTATCAAACGTCTTTTAGAACACCTCGCCGAGTCCGCCCATTATTCCCAG
AAGGACCTCGAACCGATAGAGCAGAAACTTAATAATATGCATGCAAATGT
CGAGCAGGGCGGCCCACTTTACAATCCGTTAATACTTGCCATGCTCCGCG
TCAAGATTGTCGCTTGCCAGCAGTCCCTGAGGGTGCTCAAAACAGCGCTA
GGTTCCATTCCTCCAGAAATAGCTCATGTGCATCAGAGGCTGGTGAGCAT
GAGACGGTGCATTAGAGCTTGTGAGGCTAAGCCTAAGTTCTCTGAAACAG
AGGTTATGGGATATCTGGCGACGGTTAAGGAGATCGATGCCACCCGGCTT
GAT

Sequences in the Contig:

SY0AAA4YM15FM1 SY0AAA54YK07FM1 SY0AAB29YE06FM1
SY0AAC20YN24FM1 SY0AAC58YD19FM1 SY0AAD28YO15FM1
SY0AAD36YP15FM1 SY0AAD52YP14FM1