Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1424
Length(NT) : 655
Best Gene Model Blast : Link to GSTUMT00010488001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_05249
Accession: ref|XP_001795657.1| Score: 311 E_value: 5e-27
KEGG Definition: hypothetical protein [EC:3.6.1.-]; K01529
Accession: ani:AN4412.2 Score: 288 E_value: 1e-24
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0948 Score: 266 E_value: 2e-24
PFAM Definition: No Hit Found
Swissprot: P47047|MTR4_YEAST
Gene Ontology:
GO:0005730 = Cellular component: nucleolus
GO:0031499 = Cellular component: TRAMP complex
GO:0006406 = Biological process: mRNA export from nucleus
GO:0043630 = Biological process: ncRNA polyadenylation during polyadenylation-dependent ncRNA catabolic process
GO:0016075 = Biological process: rRNA catabolic process
GO:0006364 = Biological process: rRNA processing
GO:0016078 = Biological process: tRNA catabolic process

Sequence:
>Contig1424
CCCTTCAACTTCCGACTTAGAGACAAACGTTTCTCATTACAAGAGTCGCC
CCCTCCTACAGTTACACCTTAATTCTTACTTGCCTCAACGACAATGTACG
GTGAGGAGCTGTTTGATGTCTTTGAGCCTGGGAGCCTCAAAAACGATGCC
CGCCCATCCAAATCGAAGAAAGATCGCTCCGAACGGAAAAAGAGACTCGC
AAACGGCGGTGGCCGCCCACAGGAGAGCGATGGTGATTCTATAGTAGCGG
AGTCGCGGACTGATGCCATGTCGTTGGATTCTGCTCCTGTCGTGGGTGGA
GGGGGGGGAACAATAACTTCACCCGGAAACCTACCGTTAGCGAAACGTCA
ACGTCGGGAGTCAGGCGCAGATCCTATTGCTGCAGATGTTTTTGAGATTG
ACGCGGCAAGAGAGGTTCCTGCGTCAAGTGGGCTAACGTCCCAGGATACA
GAAGGAAAATCTATCATCATCCCGCACCAAGTACGCCATCAGGTTTCCCT
TCCCACGGACTACCAATACAAACCGATTGAGAATCACATATTCGTTGAAC
CTCCAGCAAGAGCGTATGGCTTCACCCTAGACCCTTTCCAGAAGACGTCG
GTGGCTGCAATCGAGCGGGGAGAGAGCGTGCTGGTTAGTGCGCATACAAG
TGCCG

Sequences in the Contig:

SY0AAA4YM10FM1 SY0AAD56YI15FM1