Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1423
Length(NT) : 775
Best Gene Model Blast : Link to GSTUMT00009839001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: AAR034Wp
Accession: ref|NP_982575.1| Score: 509 E_value: 7e-50
KEGG Definition: AAR034Wp [EC:6.1.1.9]; K01873 valyl-tRNA synthetase
Accession: ago:AGOS_AAR034W Score: 509 E_value: 4e-50
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0432 Score: 500 E_value: 2e-51
PFAM Definition: tRNA-synt_1, tRNA synthetases class I (I, L, M and V). Other tRNA synthetase sub-families are too dissimilar to be included..
Pfam Number: pfam00133 Score: 286 E_value: 1e-26
Swissprot: O75005|SYV_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>Contig1423
TTGGCAAATAACCATCCTCATCTCTTCTTACCATAACTCTCTCACACATC
CCAGCGATTAATTTAGCTCCTACTTGAAATCGACATCCTCGCAGTCCACC
GCCAAAAAAAACATAAACCATGGCGACAAGTTCAGCCTCATCAAATCCGA
TCGGCCACGAAACAGGCCCTATCACAGACTCCGTCTCCAGCCCTTCGACA
GAGAAAAAGGCTGCTGTTCAAGATGCCGTGAATGCTGATGCTAAAGCTGC
GGGTTCACCAAAGCCAAAGACTGAAAAAGAGCTTGAAAAGGAACGCAAGA
AGGCCGAAAAGGAAGCTAGGTTTTCTGCGAAAAAGGCGAAGGCTGACGAG
GCTAAAAAGAACGCTCCCCCAAAAGCCGAGAAAAAAGGGAAGAAGGTAGA
GACTGCTGTTGTCGCGCCATATGTGGAGGAGACTCCTCCGGGACAGAAGA
AGATTCTGAAATCTCTTGATGATCCAGCCTACAAGTCTTACAATCCCGAG
GTCGTTGAATCGGCGTGGTACGACTGGTGGGAGAAGGAGGGATTCTTCAG
TCCAGAGTTCACACCCGAAGGTGGAATTAAGCCTGAAGGGATGTTCATGG
TTCCAGCCCCTCCGCCGAATGTTACAGGTGCGTTACATATCGGGCATGGC
TTGACTATCGCTATTCAGGATACCATGATCAGATGGAATCGCATGTTGGG
GAAGACGGTCCTCTTCCTGCCCGGATTCGATCATGCAGGTATCAGCACAC
AGAGTGTGGTAGAGAAAATGCTCTG

Sequences in the Contig:

SY0AAA4YM08FM1 SY0AAA60YI15FM1 SY0AAB20YH17FM1
SY0AAB23YF21FM1