Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1422
Length(NT) : 2014
Best Gene Model Blast : Link to GSTUMT00005001001 E-value : 0.0
Numbers of ESTs : 153

Blast Results:

Nr Definition: hypothetical protein An04g06250
Accession: ref|XP_001401988.1| Score: 1287 E_value: 1e-139
KEGG Definition: hypothetical protein
Accession: ang:An04g06250 Score: 1287 E_value: 1e-140
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0254 Score: 332 E_value: 2e-31
PFAM Definition: MFS_1, Major Facilitator Superfamily..
Pfam Number: pfam07690 Score: 346 E_value: 4e-33
Swissprot: Q00357|TOXA_COCCA
Gene Ontology:
GO:0016021 = Cellular component: integral to membrane
GO:0019534 = Molecular function: toxin transporter activity
GO:0006810 = Biological process: transport

Sequence:
>Contig1422
TTGGCCAACTTTTTTGTACAAAGTTGTCCTTGGGCAGCATTGGCTCTTCT
CCTCTCGAGTTAGACTTTGGTTATCATAAAGAAAGAACGAAAGAGCGCAA
GTCATCAACAATGAGCCTACCATCAACGACGCCCTCACCCGGGCCAGAGT
TCAATGAGAAGAGCCTTGGGGTACCTGAGCGGGACGTGGAGAGGGGACCT
TCGGCCGCTACGTCTAGTACTGGTGATTTGGTATTGGGGGATAAGTCGGC
TGAAGAGGTCCCTCCGCGAACCGTCAAGGGGGTATTATGGGTCCTCGTCG
TGATATCAATCCTCTCTTCCACATTTCTGTTTGCTCTTGACAACACAGTT
GTTGCCGATATCCAAGCATCGGTAATTACCGACTTTGGCGAGATTGAGAA
GCTGAGTTGGCTCGGAATTGCATTTGTCCTTGCGGGGTGTGCCACAATCC
TTCCGTGGGGAAAGGCGTACGGAGTCTTCAACGCGAAATGGCTTTATATC
CTCGCTGTTTTGATCTTCGAAATCGGTAGCGCAGTTTGTGGTGCTGCGCC
TAATATGAATGCTCTCATCGTTGGGAGAGCTGTTGCTGGTCTTGGAGGTT
CGGGAATGTACCTTGGTTCATTGAATTTACTGTCAGTCACGACGACTGTT
CATGAGCGGCCAGCGTATATCGGCACTACAGGATTGACATGGGGTCTCGG
AACAGTTCTCGGACCCGTCGTCGGCGGCGCTTTCTCCGAATCTCCAGCAA
CCTGGCGCTGGGCATTTTACATAAACCTGCTGATCGGGGCACTCTTTGCC
CCCGTCTACCTCATGCTCCTCCCCTCGGCAGACCCCCAGGCCAACACACC
CTTCGGGTCACGTATTAAACAGCTAGACTGGCTCGGCACTATCCTAAACA
TTGGCTCCTTCGTCTCATTGATAATGGCGATCAACTTTGGCGGAACACTC
TACGAGTGGAACTCCTCCCAGGAAATCACTTTATTCGTCGTTGGTGGCGT
CCTCATCATCGCCTTTGGTGTGACCCAGGCGTACTCGGTCCTCACTACTC
CCGCGCAGCGCCTGTTCCCCGGCGAATTTCTTCGTGATCCGTTTTTGGTA
TTGCTCTTTGCCATGATGGCGGCTGCTTCCACCGCAATCTTCGTGCCAAC
ATATTACATACCGTTATACTTCCAGTTCGTCAGAGGGGATACAGCGCTTG
AAGCTGCCGTGAGATTACTACCATTCATTATTATCATGGTGGTCTTCTGT
ATTGTTAATGGCGGGGCCATGTCAAAGACCGGGTATTACGCCCCCTGGTA
CCTCTTCGGCGGTGCGATGGTCCTAATCGGGGGATCACTCATGTACACTG
TTGAGGAAACCACGTCTACCACTAAAATCTACGGATACACCGTCCTTATC
GGAATCGGTTCAGGTTCTTACGTGCAGGCATCTTTCTCCGTCGCTCAGGC
TAAGGTCAAGCCAGGACAGTTGGCCTCCGCGGTTGGATACATCTCTCTCG
CACAGACTGGCGGAATAGTCATCGCATTGGCTATCTGCGGTAGTGTGTTC
TTAAACGAGAGTGTTAAGGGCATTACACCGTTCTTGGAGGGCGTCCCGAC
CGCAGCGATCAAGGGCGCAGTGGCTGGCAGTGGAAGTGAGCTGTTCATGA
GTCTTGAAGGGGAGACAAGAAAGAATGTCTTGCACGCCATCATCAAGGCC
ATGGATAAGAATTACATCCTCTTAATCGTGGCCGGGGCGATGACGGTTAT
TGGGTCGCTTTTTATGAAGTGGGAGAAACTCTTTTTGGAAGCCGGGCATG
CTGGTTAAGCACAGTAAGATATGACTTCTATACATAATGGAATGTATAAA
CACGATGGAAAGTGGGGTTATTGGGATTTGTTGCTGTCCATTTCTTGGCG
TTCTAATTTGTTTTTTGTTTTTTTTGTATAATGATAGACTGTCGGAGCGA
TTAGAGTATATGACCACCTGTTTGTATCCTGCTGTAATGAAATAGATTAA
TATGATACCGCTGT

Sequences in the Contig:

SY0AAA10YM18FM1 SY0AAA11YH15FM1 SY0AAA12YL16FM1
SY0AAA13YB07FM1 SY0AAA13YE11FM1 SY0AAA13YH15FM1
SY0AAA13YJ07FM1 SY0AAA14YG20FM1 SY0AAA15YE07FM1
SY0AAA16YB02FM1 SY0AAA17YD19FM1 SY0AAA17YJ07FM1
SY0AAA17YN13FM1 SY0AAA18YA13FM1 SY0AAA18YA13RM1
SY0AAA18YA16FM1 SY0AAA18YA16RM1 SY0AAA18YN05FM1
SY0AAA1YG11FM1 SY0AAA20YG05RM1 SY0AAA22YK12FM1
SY0AAA23YH07FM1 SY0AAA23YH07RM1 SY0AAA24YI21FM1
SY0AAA24YI21FM2 SY0AAA24YI21RM1 SY0AAA24YK11FM1
SY0AAA24YK11FM2 SY0AAA24YM23FM1 SY0AAA24YM23FM2
SY0AAA25YA16FM1 SY0AAA26YD02RM1 SY0AAA26YJ16FM1
SY0AAA26YJ16RM1 SY0AAA26YM24FM1 SY0AAA26YM24RM1
SY0AAA28YD04FM1 SY0AAA28YO03FM1 SY0AAA29YK12FM1
SY0AAA2YA07FM1 SY0AAA2YH22FM1 SY0AAA2YJ06FM1
SY0AAA2YJ16FM1 SY0AAA2YN01FM1 SY0AAA30YB08FM1
SY0AAA31YN05FM1 SY0AAA34YG22FM1 SY0AAA36YN03FM1
SY0AAA37YD03FM1 SY0AAA38YE13FM1 SY0AAA39YC22FM1
SY0AAA39YD20FM1 SY0AAA39YG24FM1 SY0AAA40YB23FM1
SY0AAA41YD23FM1 SY0AAA41YI11FM1 SY0AAA41YN09FM1
SY0AAA42YB13FM1 SY0AAA43YA16FM1 SY0AAA43YB20FM1
SY0AAA43YM19FM1 SY0AAA45YH23FM1 SY0AAA48YB03FM1
SY0AAA49YH06FM1 SY0AAA4YB21FM1 SY0AAA4YL16FM1
SY0AAA52YJ12FM1 SY0AAA52YN16FM1 SY0AAA53YB12FM1
SY0AAA53YL23FM1 SY0AAA53YP22FM1 SY0AAA54YJ21FM1
SY0AAA55YF15FM1 SY0AAA56YH24FM1 SY0AAA56YI03FM1
SY0AAA57YJ12FM1 SY0AAA57YO07FM1 SY0AAA58YB15FM1
SY0AAA58YC11FM1 SY0AAA5YO24FM1 SY0AAA60YJ04FM1
SY0AAA61YO11FM1 SY0AAA62YI21FM1 SY0AAA63YE22FM1
SY0AAA63YL03FM1 SY0AAA7YA18FM1 SY0AAA7YE09FM1
SY0AAA8YH03FM1 SY0AAA8YL04FM1 SY0AAB12YK01FM1
SY0AAB12YM11FM1 SY0AAB14YI05FM1 SY0AAB14YM07FM1
SY0AAB15YC18FM1 SY0AAB16YA12FM1 SY0AAB16YC18FM1
SY0AAB17YE18FM1 SY0AAB17YJ18FM1 SY0AAB18YB06FM1
SY0AAB18YB10FM1 SY0AAB19YA15FM1 SY0AAB20YF19FM1
SY0AAB21YD01FM1 SY0AAB22YE03FM1 SY0AAB26YA16FM1
SY0AAB26YC14FM1 SY0AAB26YM02FM1 SY0AAB26YP20FM1
SY0AAB27YA03FM1 SY0AAB28YB09FM1 SY0AAB29YH03FM1
SY0AAB30YP09FM1 SY0AAB31YA13FM1 SY0AAB31YF04FM1
SY0AAB31YM06FM1 SY0AAB32YC09FM1 SY0AAB32YI16FM1
SY0AAB33YC01FM1 SY0AAB34YL08FM1 SY0AAB36YA12FM1
SY0AAB36YH07FM1 SY0AAB37YA15FM1 SY0AAB39YF02FM1
SY0AAB3YH15FM1 SY0AAB3YK23FM1 SY0AAB40YA13FM1
SY0AAB40YF24FM1 SY0AAB42YE13FM1 SY0AAB42YO11FM1
SY0AAB44YF14FM1 SY0AAB47YB12FM1 SY0AAB47YD06FM1
SY0AAB47YJ15FM1 SY0AAB48YN11FM1 SY0AAB4YI21FM1
SY0AAB52YE21FM1 SY0AAB52YM02FM1 SY0AAB52YO21FM1
SY0AAB53YA23FM1 SY0AAB53YD02FM1 SY0AAB54YE11FM1
SY0AAB54YP13FM1 SY0AAB56YC07FM1 SY0AAB56YF04FM1
SY0AAB58YM16FM1 SY0AAB59YM01FM1 SY0AAB60YF19FM1
SY0AAB61YO16FM1 SY0AAB61YO24FM1 SY0AAB9YB14FM1
SY0AAB9YC06FM1 SY0AAB9YD02FM1 SY0AAD42YJ03FM1