Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1421
Length(NT) : 602
Best Gene Model Blast : Link to GSTUMT00002941001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: spt3
Accession: ref|XP_001539123.1| Score: 536 E_value: 3e-53
KEGG Definition: hypothetical protein
Accession: ani:AN0719.2 Score: 521 E_value: 9e-52
KOG Definition:
Classification: [Transcription].
Kog Number: KOG3902 Score: 536 E_value: 9e-56
PFAM Definition: TFIID-18kDa, Transcription initiation factor IID, 18kD subunit. This family includes the Spt3 yeast transcription factors and the 18kD subunit from human transcription initiation factor IID (TFIID-18). Determination of the crystal structure reveals an atypical histone fold.
Pfam Number: pfam02269 Score: 286 E_value: 8e-27
Swissprot: O13472|SPT3_KLULA

Sequence:
>Contig1421
TCGCCCATCATGTCGAACGACAAATTCAAATATCGTGTTGAAATTCAGCA
AATGATGTTCGTTTCGGGCGAAACCGGCGAACCATCTGCAGAAACCACAG
GAATCATCGAAGAGATTGTGCGGGGCCAGGTTATCGAGATGTTGCAACAA
TGCACCAATCTTGCGTCACGTCGCGGGTCTCGCTCCATTTCGACCGATGA
CCTCATCTTCCTCATCCGTCATGACAAAGCGAAGGTTTCTCGCCTACGAA
CTTATTTATCCTGGAAAGATGTTAGGAAAACCGCCAAAGATAACGATCCA
TCTGGGGGAGCTGGTGCGCCCGATCCTGCCGACCTTCTCGACGACGCGGC
TGCAGGCATTGCGGGCGGGACTGGGCCGGTTCAGATGAGGCAGAAGAAGG
CAAAGATCGGACTCCCATGGGAGGTGGCTAGTTTTTTCTCGGAGCAAGTC
CCTGAACGCGAAGAAGATGAGGACGAAGACGAGGTAGAGGCCAACGCGGC
CACACTACAGCGCCTCAAGAATGCGGATGAACGTACGAGAGGTATGACTA
GGGACGAATACGTACATTGGTCGGAATGTCGCCAAGCTTCCTTCACATTC
CG

Sequences in the Contig:

SY0AAA4YJ13FM1 SY0AAC41YN05FM1 SY0AAD42YB09FM1
SY0AAD42YC23FM1 SY0AAD48YM12FM1