Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1420
Length(NT) : 1149
Best Gene Model Blast : Link to GSTUMT00010864001 E-value : 0.0
Numbers of ESTs : 11

Blast Results:

Nr Definition: hypothetical protein SNOG_14965
Accession: ref|XP_001805131.1| Score: 340 E_value: 6e-30
KEGG Definition: hypothetical protein
Accession: ani:AN9498.2 Score: 309 E_value: 1e-26
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG4234 Score: 303 E_value: 2e-28
PFAM Definition: Tymo_45kd_70kd, Tymovirus 45/70Kd protein. Tymoviruses are single stranded RNA viruses. This family includes a protein of unknown function that has been named based on its molecular weight. Tymoviruses such as the ononis yellow mosaic tymovirus encode only three proteins. Of these two are overlapping this protein overlaps a larger ORF that is thought to be the polymerase..
Pfam Number: pfam03251 Score: 117 E_value: 8e-07
Swissprot: Q99614|TTC1_HUMAN
Gene Ontology:
GO:0051082 = Molecular function: unfolded protein binding
GO:0006457 = Biological process: protein folding

Sequence:
>Contig1420
TTGGCCCAACCAACTTATAGCATGGCATGGTACGCTCCACCAGAATAACA
ATATAAGTATGCCCCCTTCCCCACCCTTCCACCACGATGGATGCGACAGC
GACGACGATGAGGACATGTTCGTAGATTCCCACTCCCACCAGTCAGCAAG
CCCAACTACTACCGGCATGTCCGATACCACACCACCACCGACCCCATTCC
AAAGCACTCACGAGCAGCAGCAGCAGCACCCCACCATGGAGCGTCGACTC
GGTAGTTTTTCCGCGGGGAGTGAGGCGCTGGGCGGATTCGTCTTTCCGAG
CACGAGCGACACGGCGGAACGGGATATTCGCGAGGTGGATGGTGACGACG
ACGACGGGCATATGGACACTTCGGAGGATTGCGTGGCGACGGCGAGAGTA
GCGGGCGCTAGGGAGGGGGAGGAGGATGAACACAAGCCCATGAAACCACC
GCTCGGAGAGAGGTTTTCGAAGGATGAAGAGAATCGCCTCATAACAGAGT
CTACCTCCTACCGCATCTCGGGAAATCGTCTATTCAACTCCAACTTTCTC
CTCCCCGCGCTCGACGCGTACAAGCTCGCGCTGACCTCGTGTCCAATCTA
CCTAGTCCACGAAGTGGCGACGATATATGCCAACATCGCTGCTGTGGAAT
TGAAGCTGCAGCGCTATCCCGCCGCCGTTAAAGCCGCCACAAAAGCGCTG
GAAGGTCGGCCGCGCTGGGGGAAAGCATTGTACAGGAGGGCACGGGGCAG
GGAGGGGATTGGCGGTTGGGCGGAGCTGGAGGGGGCGTTGGAGGATTACA
GGGCTGTTGAGGCCTCGGCCGGTGGGGCTGGGGGTGCAGCGGCGGGGGGA
ATTGGCGAGAAGGAATTGGAGATTGTCAGGGAGAAGATTCGCTGGTTGCC
CGGCAGGATCGAGGAGGTTAAGGATACCGAGACAGCGGAGGTTATGGGGA
AATTGAAGCAGATGGGCGAAGGGTTGCTCAAGCCGTTCGGGATCAATACT
AGTGATTTTGGAATGGTCAAGGGCGCAGATGGGGCGTATAGTCTCCAATT
TCGCAGGTCGTGATGTTATGGTCTTGTTCTGTGCCCTCCTGCTCCCCCAT
CACTTTTTGTCTACCTTACTTTTCCTTTCTTTTTTTACCCTTTCTCTTC

Sequences in the Contig:

SY0AAA36YH02FM1 SY0AAA3YH06FM1 SY0AAA4YI24FM1
SY0AAB19YJ09FM1 SY0AAB39YF17FM1 SY0AAC10YL11FM1
SY0AAC46YC16FM1 SY0AAD17YD11FM1 SY0AAD24YK19FM1
SY0AAD3YH04FM1 SY0AAD43YL06FM1