Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig142
Length(NT) : 639
Best Gene Model Blast : Link to GSTUMT00009122001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: small nuclear ribonucleoprotein SmB, putative
Accession: ref|XP_001271668.1| Score: 374 E_value: 2e-34
KEGG Definition: hypothetical protein
Accession: ang:An04g02130 Score: 371 E_value: 2e-34
KOG Definition:
Classification: [Transcription].
Kog Number: KOG3168 Score: 372 E_value: 1e-36
PFAM Definition: LSM, LSM domain. The LSM domain contains Sm proteins as well as other related LSM (Like Sm) proteins. The U1, U2, U4/U6, and U5 small nuclear ribonucleoprotein particles (snRNPs) involved in pre-mRNA splicing contain seven Sm proteins (B/B', D1, D2, D3, E, F and G) in common, which assemble around the Sm site present in four of the major spliceosomal small nuclear RNAs. The U6 snRNP binds to the LSM (Like Sm) proteins. Sm proteins are also found in archaebacteria, which do not have any splicing apparatus suggesting a more general role for Sm proteins. All Sm proteins contain a common sequence motif in two segments, Sm1 and Sm2, separated by a short variable linker. This family also includes the bacterial Hfq (host factor Q) proteins. Hfq are also RNA-binding proteins, that form hexameric rings..
Pfam Number: pfam01423 Score: 155 E_value: 2e-11
Swissprot: Q10163|YAU8_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005685 = Cellular component: snRNP U1

Sequence:
>Contig142
TTGGCCCTCGCGAGCCTCATTACTTTATTCAATCATCGTGACTAGAGGAG
CTCTAAAGGCGGCTTGTCCTATCCCGCTAGCAATCATGTCTTCAAAACAA
CAAGGAAAAATGGCCAACCTCATCAACTATCGTATGCGGGTGACAATGAC
CGATGGCCGCCAGCTAACAGGGACGCTTTTAGCGTTTGACAAGCACATGA
ATGTCGTTCTAGCAGATACCGAAGAATTCCGCCGCATCAAACGAAAACCT
AAAACTACCGCTCCAGCTGCCAGCACCGTAGGTCAGATCACCGAGGAAAA
GCGCACCCTAGGTCTCATCATCTTGCGAGGACTTCACATTGTTTCTTTAT
CCGTCGAGTCTCCACCCCCAGCGGATCCCTCTTCTCGTTTAGGCACGACT
ACCGCTGGTGGCCCATCGGCTGCTGGTGTTGCGGCTGCCGGACCGGGCAT
CAGTAGGCCTGCCGGGAGAGGGCTCCCGATCATTGGTATGGGGGCTCCCC
CACCTCCGGGAGGGCTGCCACCACAGATGGGTGGGCCTGTGGGCTTGCAG
GGTCCCATGAGGAATGTTGGTCTTGGACAGGCCCCACCTCCGATGGGTGC
CGCTCCCCCGCCAGGTGGGTTTCCCGGAGCCCCCCCCCC

Sequences in the Contig:

SY0AAA15YD15FM1 SY0AAB16YI02FM1 SY0AAB17YI09FM1
SY0AAB33YN06FM1 SY0AAB38YE09FM1 SY0AAC21YA20FM1
SY0AAC45YE03FM1 SY0AAD33YE13FM1 SY0AAD36YE01FM1
SY0AAD41YA07FM1