Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1419
Length(NT) : 631
Best Gene Model Blast : Link to GSTUMT00011753001 E-value : 2e-77
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein SNOG_05045
Accession: ref|XP_001795457.1| Score: 152 E_value: 1e-08
KEGG Definition: hypothetical protein
Accession: fgr:FG05186.1 Score: 129 E_value: 3e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1419
TTGGTAACCTTCCTCTCCTTCACTCACAACCTCCCCCCCACAACAGCATC
ATCACTGCTACCACTGCCACTGTCCGAGTCAGCACCACTAAACACAGAGT
CCTCTCATTCATCTTCGTCGATTTCGAGTACTGTCTCGTCCTGCGCCTAC
GCACTAAAACAGCCCTTAATTGAAATCCGAACCCAACTGTTACCACCATC
AACCATATTATCATCACCCTTGCTTGACACTACGTAACCCAAATTCGTAA
AACCAAACCTCCACTCACTTCTTTCCCCCGCTACCAAACAATCAAACATT
ACAATTGCAATGGATTGGTCTCCGGATTACTGTCTCTCTTGCGATCGTCA
GATCTCTCAATCTGGCCATGGAGCTTACTGCTCGCAATCCTGCCGCTTGG
CAGATTTAGAGCGCGCTTCTTGCCGCTCGGGCTCATCATCACCACAGGCT
GGGGCTTCGTCCTCGCCTTCGTGGTCAGGGTCAAACATGGGCTCTGGTGC
TGGTTTCTACCTCCCTCCTCCTCTCAACTTCTCTGCCATGTCTGGCAGAC
AGACTAGCTCAGCCGCTTCGTCACCGACAACCAGAAGCCCTCTGTCATCC
ACTCCTCCCTCACAATACTCATCTCCATATG

Sequences in the Contig:

SY0AAA24YE12FM1 SY0AAA24YE12FM2 SY0AAA4YI17FM1
SY0AAA53YD04FM1 SY0AAA9YF06FM1