Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1418
Length(NT) : 1884
Best Gene Model Blast : Link to GSTUMT00010877001 E-value : 0.0
Numbers of ESTs : 17

Blast Results:

Nr Definition: hypothetical protein MGG_04146
Accession: ref|XP_361672.2| Score: 772 E_value: 9e-80
KEGG Definition: hypothetical protein; K05776 molybdate transport system ATP-binding protein
Accession: mgr:MGG_04146 Score: 772 E_value: 4e-80
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0927 Score: 411 E_value: 1e-40
PFAM Definition: ABC_tran, ABC transporter. ABC transporters for a large family of proteins responsible for translocation of a variety of compounds across biological membranes. ABC transporters are the largest family of proteins in many completely sequenced bacteria. ABC transporters are composed of two copies of this domain and two copies of a transmembrane domain pfam00664. These four domains may belong to a single polypeptide, or belong in different polypeptide chains..
Pfam Number: pfam00005 Score: 188 E_value: 9e-15
Swissprot: Q9UT95|YL44_SCHPO
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>Contig1418
TTGGATTCCACTCTCCTCTCTCGCCACTTATGATATCATACCAGAGTTGA
AAATATAGAATGTCCCGCCACCCTTTGATCTCGATAACCTCCACCTCCTT
CCGCCCCATAACCTCCCCGCTTACTGCACCGATACTGTTTCCCAACACAA
CATTTGCCCTCCATCCCGCTCAGAAATGGTCAATCCTTGGGTCGTCAAAA
TCAACTCTCCTATCCATCCTCTGTGGTAGTCACATCGCTATCCCACCTAC
CGGTCGATGCTATCCCGGTCTACGGGGCACCATTGAACTCGTCTCTTTCA
CCACTGGGAGCAAGAGTACGGGGATGCTTGCTGGAGCTAACAGTGGGGAA
ACCTACTTGTCTGCACGGTATGAGGCTTGGAGGGAGGAATCTGATGTTTC
TCTAAGGACGTGGCTGGGAGGTAGTATTGCTGGGAAGAATCCTTTTGAGG
AGGGAGGGGAGGTGAAAGGGAAGGAAGCACTGGGGGAGAGGAAGAAGAAA
GTGGAGGATGTCGCGGGAACCTTGATGCTACGGGAATTTCTAGATCAAAG
TGTTATGACGTTGAGTAATGGACAGAGCCAGCGGGCAAGAATTGCACAAG
CGCTTTTGAAAAGACCGGAGGTGTTGGCTATTGATGAGCCGTTTATGGGA
CTCGATCCTCCGTCTCGCAATTTACTATCAGAACTACTCTCCCGCCTCCC
ACGCGCCCCACAACCGACACAGATACTGCTCGGTCTCCGCCCGCAAGACC
CTGTACCAGCCTGGAGCACACACATAGCATTTATATCTAACAACCGTATC
CTCGCGCAGGGCCAAAAAGAATTCGTCATCTCGACCCTCCGTCGATCCGG
AAAGACAATCCTACAAGAAGGCGACGACACCCAAAAACCCGCCCCAACCC
TCCTCGACAAAGTCTGGTCCGCCCCCGCGGTCCCGGCGTCCATATCACAA
GATCGAATCACGCTGCCGTCAAAATCTACCTCCAGCCCAATTCTGATTCA
AATGAGCAACATCCAAATAACATACCCCCCACACCCCCCCTTCCTACAGA
ACTTCTCCTGGACAATCCGAGCCGGCGAGCGCTGGGGTCTCTTCGGCCCT
AACGGATCGGGGAAGACCACACTGATATCCCTCCTAACTTCTGATCACCC
GCAGACCTATGCCCTACCGATAACACACTTTGGCCACCAAACTCGCATTC
CAGGACCCGGAAGACCGGGCGTCAGCATCTTCGACGTACAGAAGCGCATC
GGACACGCATCCCCAGAAGTCCACGCCTTCTTCCCAAAAGCGTACACTCT
CCGGCGCACCATCCTCTCTGGCCTTGCAGAGACCTTCCGTGCGAAGCCCC
CACCAGCAACAGAATACGCAGAGACGCTGCTCGCCGAATTCGAAGACATC
GTCGCCGGCCCGGGTGGTTGGGACGACACTGTCTTTGGCGAAGCGTGCTT
GAACGTTCAGCGCCTCGCTCTGTTCCTGCGTGCCGTGGTGGGTAAGCGCG
AACTGCTGGTTCTTGACGAAGCCTTTTCCGGCATGGATAATGCGGTTAGG
GATCGCTGTTTTCGTGTTCTTGCACATGGGTTCGACCACGCGCGCCAGGC
ACTTGTGGTCGTTAGCCATGTCGGCGAGGAGGTGCCCGAGGTGGATATGT
GGGTCAGGTTGCCGGATAGGGGGAGTGATGCTTGCGCAGTTTATGGGTAT
GCGTAGAGTGGTGGATATTATATCCCCGAAGTGGTTCAATCTAGAAGTCA
GAACATGGAATATCACTCGTGATTCATTCTCTGTTTCTGTTTCTGAAATC
TGCTTTGGGTTCGGGGGGCCACAGGGGAGGGATGGCCAGAAATAATATTT
CGTTGGTAGAGATGCTGCAAGCATTGGTTCATAG

Sequences in the Contig:

SY0AAA4YH24FM1 SY0AAC17YG19FM1 SY0AAC21YF22FM1
SY0AAC30YC07FM1 SY0AAC34YF21FM1 SY0AAC43YD01FM1
SY0AAC58YF19FM1 SY0AAC61YH16FM1 SY0AAC6YD13FM1
SY0AAC7YH15FM1 SY0AAD30YB09FM1 SY0AAD32YI23FM1
SY0AAD47YL23FM1 SY0AAD48YL10FM1 SY0AAD57YF10FM1
SY0AAD7YK18FM1 SY0AAD8YJ04FM1