Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1417
Length(NT) : 844
Best Gene Model Blast : Link to GSTUMT00011686001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE56117.1| Score: 687 E_value: 2e-70
KEGG Definition: permease of the major facilitator superfamily
Accession: aor:AO090005001154 Score: 687 E_value: 1e-70
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2615 Score: 402 E_value: 6e-40
PFAM Definition: MFS_1, Major Facilitator Superfamily..
Pfam Number: pfam07690 Score: 251 E_value: 2e-22
Swissprot: P25351|YCR3_YEAST

Sequence:
>Contig1417
TTGGTCCCTATACAAAGTACCCCTATCATACGACGAGACTCAACACGTCG
TATGGCCGGATAACTCTTTATTTCCAATCTTCCCTTTCTATCCCTCTCCC
TCGCTCCCGTCCCCCCCCGTCCCCTCCTTCTTCAGAAGGTTACTGTTCTG
CATACAGTGCTCACCCATCAATCTTAATGGCCGCAACTTTACCACGGAAG
GAGTTTCCTACACGTCAGCTGTTTGTACTTTCATTATGTCGGATCTGCGA
GCCTATTTCGTTCTGTTCGATTCTTCCGTATATCTATTATATGATTGAGT
CGTTTGGTTGTGCCAAAAACCCAAATGAAGTCGCCGTCTACGCCGGTATG
GTTACGAGCTCTTTTGCCTTCGCTGAGTTCACGACCGGGATGATGTGGGG
CAGGGTCTCAGACAAATTTGGGAGAAAGCCGGTCTTGATCATGGGTCTTG
TGGGGACTATGCTTTCCATGTTGATATTCGGATTTGCAAAGAGTTTTCCT
GTAGCTTTGATTGCGCGTGCGGTTGGTGGGGCACTAAATGGGAATGTCGG
GGTACTTCAGACGACGGTTGCCGAGCTGGCCACCGAGAGGGAGCATCAAG
CGAGGGCTTTTGCTGTCATGCCCTTTGTTTGGTGCCTAGGGTCTATTGTC
GGTCCCGCCCTCGGTGGTCTCTTGGCCGACCCCGTGAAACAATATCCGGC
TATGTTCCACCCTGGCGGGGTTCTTGAGGAGTACCCATATCTCCTACCTA
ACCTAGTATCTGCGAATATACTGGCGGTGGGAATTATAATTGGGACTTTG
TTCCTGGAGGAAACTCACGAGATTCTCCGTGAGAAACCGGATAT

Sequences in the Contig:

SY0AAA1YM11FM1 SY0AAA4YH14FM1 SY0AAA61YH04FM1