Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1416
Length(NT) : 1109
Best Gene Model Blast : Link to GSTUMT00001671001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1416
TTGGCACAACATCAATTACTACTACCTATGCGAAGGACCTCTATGAGCTC
TGCCAGTCCCATGTCCGCTTAGTCCCGCTCTTCACCTTCGAGCAGAATAA
GCCGCAGGAGTTTACTGTTGTTTTAAAGTTGGTTGGACCCCTTGAGTCTA
AGGAGATTGTGGTCGACGGAATATTCCCATCAAAACGGCATGCAAAGGAA
GCGGCCGCAGCATTGGGTATCGAATACGTTCGCGATCTGCCTAAGGATGG
ATCGTCACGGTTATTCACTATGGACCAAGAACCGGAGAATTGGGTTGGCT
TGTTGAGCGACATGTGCAACGGAAAGCAGATTCGGCCCCAATACACCGAC
TATGCTACTCCCGGCGCCGGTTATTCCTGCGAAATAAGACTGGGTGCGGA
ATTCGGATTCCCGGGCGTGGAGTGTATGGTCTTTGGGGATAAACATCGCG
CCTTCAAAAACAAGAAGAGTGCGAAGATCGCCGCGGCCAAGGAAGCCATT
TTGTGGATTCGCGAACAGGCACCTCCAGGAACTCCTGTTAATGGCCGGAC
TCCCAGGGCAGCTGCAAGCGGTCCCGAAGGCGTAGTAGATATTCCAGAGG
GTAAACCTACGGCCCAGATTGTTAATCTTATCTGCCCAAAACTAGGTTTC
ACCTCCCCGGAGTACATCTTCCATGCCGATCCCCACGCTCCTGGTCTATA
CGACGTGGACGCAGTGATTAAGCGTCCAAAAGGTCCACGTCCAGCCAAAA
TTGGTCCGATCCGCAGTGTCTTTGGCAAGAAGAAGGCTCGTGACGAAATC
GCTACTTGTGTACTCCGCTGGCTCCGCAAGGAGGCAGAAAAGCAGGGACT
CAAGATTGTTGAGCATGATGAGGTTAATGGTGCCCGGGAGGATTATAGCT
CTTCTTAGCCATTTGGCCACTACTTGACTTGGTTATTTTGTGGTTTGGGG
GAGAAACAGCAATTGATGGAAAAAAGTCTGGGGAAAAATTTTTAGTCTTG
TTTCCGGTTCGGTTAGTTCGATGAGTTCTCCCTCCTTTTTGTCTGTCCTT
TTCTGCCTATCATAATCGAATCCACTATCTCTTCCCCCCATCCCCCTCTT
CTTTTAATA

Sequences in the Contig:

SY0AAA4YH07FM1 SY0AAC14YI15FM1