Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1415
Length(NT) : 681
Best Gene Model Blast : Link to GSTUMT00004324001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: inositol hexaphosphate kinase KCS1, putative
Accession: ref|XP_001259360.1| Score: 358 E_value: 2e-32
KEGG Definition: inositol hexaphosphate kinase KCS1, putative
Accession: afm:AFUA_5G13240 Score: 351 E_value: 6e-32
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q12494|KCS1_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0042802 = Molecular function: identical protein binding
GO:0000827 = Molecular function: inositol 1,3,4,5,6-pentakisphosphate kinase activity
GO:0000829 = Molecular function: inositol heptakisphosphate kinase activity
GO:0000828 = Molecular function: inositol hexakisphosphate kinase activity
GO:0032958 = Biological process: inositol phosphate biosynthetic process
GO:0010526 = Biological process: negative regulation of transposition, RNA-mediated
GO:0042493 = Biological process: response to drug

Sequence:
>Contig1415
TTGGTGATTTTTCGGATAGTTACGATGAGCTTTCAAGTGGCGAAAATGAT
CGTAGTGGGAGTGGCTATGGAACTGCTTTATCTGAAACTGAGGATACCAC
CCCAACTGCTACGCCCATTGCCCGGCGCCCTCATATCAAGTACGATCAAA
CTCTTGGCAACCGAAAGCAGCATTCTTCCAGTGCCCAGTCGAAGGCCGTA
CCTCAAGTTCCTTTGGGGGCTGTTGAGTTAAAACCATACAATCATCAAGT
TGGAGGTCATACAGCATTGTTCAGATTCTCCCGCAGAGCTGTTTGTAAAA
GCTTGAGTAATAAAGAAAATGAATTTTATGAGGCTGTTGAGAAGAGGCAT
CCGCAACTTTTAGGATTTCTACCAAAGTACATTGGGGTTCTTAATGTTAC
CTTCAGAAGAGCACCAAAGAAGAAGAAAACCATCAAAAAGGAGGCTGCAA
CAGGCTCACCTGAGGTGAGCGGATTGGCAACGGAAAGCGAGGTCTTTGTT
AGGAGCGGCAAAAATTGTGCAGACTCTCAACCAACCGAGACAGAGTTTAC
GAAGGCTCCGAATGTTGTATATAACTCGGAGGCGACCTCTGGGGGTGCAC
CCTTTCCTCTTCCCCAGGTGGTCTTCGAGAACAACAGACACATTATTCCT
GAAAATCTTTTTCGCTTTTCGGCCAGTGCCC

Sequences in the Contig:

SY0AAA4YH01FM1 SY0AAC33YA05FM1