Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1414
Length(NT) : 616
Best Gene Model Blast : Link to GSTUMT00011264001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1414
TTGGGCGGTAACTTGATCGAGGGAACTCCGGCTACCGCAGTGCGATCGAA
TAGCAGGCCGGCAGATCAAGGGAGTCTGCACAGGTATTTCGGGCAAAGGA
TGCCAGAACCGGTGAGAAAGGTTGTTCCGCCTAAAGCACACACTGCGACG
GAGGTCATAAGGGACAAATCTATAAGGGATAAGAGTCTTAAGGAACAAAT
TGAAGCGCTACCTCAGCCCAAATTCCCCGTCCGACCTGACCATCACAGTG
ATGTCATGTTATTGAGTTCTTCGCCTGCGCGTGCGCCGCCCAAGAGAAGG
CGAGAGAAAGAAGAAATCCCCTCCTCACCACCGGCGTTTTCCGTGCCGTT
TTCTAGATACTTAGAGTCAGCGGTAGCGGAGAGGTGCGTTGAGATTGAAG
AGACTACCATCGCTGGAGCGTCGGCTGCAGTTATACATAACGCAGCAGGC
TCAAGGAATACAACTACGGTGACAAATCCCAATGCTGTAGCGATGGCCGC
GACAGCGACCACGGCCCCGAAGAGAAGAACTTTGGCCGTTCGACGGAGTA
TGGGTGATGGATGGAGAAATAGGGCGAGTGCTAACCGATGAAAGGAATTT
GGGGGATTGGTTTGTT

Sequences in the Contig:

SY0AAA4YG20FM1 SY0AAC51YN23FM1