Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1413
Length(NT) : 862
Best Gene Model Blast : Link to GSTUMT00004076001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CHGG_05671
Accession: ref|XP_001221766.1| Score: 574 E_value: 3e-57
KEGG Definition: hypothetical protein
Accession: ncr:NCU06407.1 Score: 565 E_value: 1e-56
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: O59746|YN2B_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig1413
TTGGCGGCCTATATGGTGAGAGTTGTGGCTCTTTACGGAAGAGTTGTAAA
ATATCTTAACCAGGGGGGCAAAGACCGCGACCCTTGTGAAATTTGGGAGC
CAAATTCCCAGTTTACATCCCTTAACAAGGAGATAGCCCGATTTGAAGAG
AACCTACCTAGTCGTTTCCGATATACTCCCGAAAATATGCAGGTTCATAT
CACAGAGCGTCTCGTTGGCCAGTTCGTTTTCGTGCATATTGCCCTTCACC
AAGTACGACTCTTTCTCAACAAATCAGGAGTTCCAACGCCTACCCCCCAG
CGCCAGAGCACCCCTCTAGAGTTCGGAAAGAAGGCGGGGGAAATCGCCCT
GTCCTCGGCGACCGAGATATCACGAATACTTTTGGATGCCGAGGAACGTG
GAGTGATTGTGGTGGCTCCTTTCACGGGGTATTGCGCATTCAATGCTAGC
ATGGTGCACATGGTGCGGATGTTCTCATTCTCTAATAGAAGAGAGATACA
GGAGGAATCGAGAAACAATATGCAGATATGTCTAAGGTTCTTGATGCGAC
TAAGACAATATTGGGGTCTCTTCCATGCTTTAACAGATAATCTCAAGAGA
TTATACCGTAAACTTGCCGACTCCCTTGCACGGGGTTCGTCGTTCCCTGA
AGAAACCACCCGAACGTTGCAGTATGGAGACTGGTTTCAAAAGTACCCAC
GAGGGGTGAGCGCTGGCGACTACGAAGTAGAAATGACATCAAAGCCCCAT
ACTTCAGACGAGGCCTCCACCCAAGACGCTGTGCTGAGCCAAAAGTCAAA
TCTTCAAACCGCAGACGAGTTCTTTGCAAGGTTAGGACCATCGAGACAGA
AGCGGCCTCCAG

Sequences in the Contig:

SY0AAA4YE21FM1 SY0AAA60YN09FM1