Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1412
Length(NT) : 730
Best Gene Model Blast : Link to GSTUMT00001651001 E-value : 0.0
Numbers of ESTs : 12

Blast Results:

Nr Definition: hypothetical protein BC1G_09030
Accession: ref|XP_001552848.1| Score: 523 E_value: 2e-51
KEGG Definition: hypothetical protein
Accession: fgr:FG02433.1 Score: 505 E_value: 9e-50
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1336 Score: 282 E_value: 4e-26
PFAM Definition: Rieske, Rieske [2Fe-2S] domain. The rieske domain has a [2Fe-2S] centre. Two conserved cysteines that one Fe ion while the other Fe ion is coordinated by two conserved histidines..
Pfam Number: pfam00355 Score: 167 E_value: 7e-13
Swissprot: Q10499|YDGE_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>Contig1412
TTGGCCCGCTTGAATGCAACACGCTCTCTCTTTACTACGATCCACCACCG
TTGGCCAGGCCTCTTTCGTTCGAGCTTCTACTTGCCCAGGAATATACTGC
ACACCACAGATTTTGAAGCCGAGCTTTGCTAGAATACCCGCTCTACCAAT
TTTGGCTAGCAGGGCAATGGCTACTGTTCAGGAATACAAGCTTAAGTTGG
ATAATGTGGACCTAAGGAATAGGGAGAAGGTTGAGGCGGAAGTTGAAGGA
GTAGAGGGCGGGAAAGTGATTTTGCTAAAAGTTAATGACCAGTTGAGAGC
TTTGGGGGCCAAATGCACACATTACGGAGCACCGCTGGTTAAGGGTGTGA
TTGCTGGTGATGGGAGAATTACTTGTCCCTGGCATGGAGCTTGCTTTAAC
ACCGACTCGGGGGACATTGAAAATGCCCCCGCCCTAGACCATCTAGCCGC
ATTCCCGGTCTCAATCAAGAATGGCGCAGCCTATATCATTGGTGATGAAG
CGACAATCAGAGCTGGTAAACGGAAACCAGATGTTAGTTACAAACCTGTT
ATCACTGCTGCCTCGGAGCATGTTGTCATAGTTGGAGGTGGCTCTGGGGC
CATGGGGGCAATCGAAGTCCTCCGTGAGAAAGGCTTTAAGGGCCAAATCA
CAGTTTTAACAAAAGAGAGATATCTACCGATAGACAGAACCAAGCTCTCC
AAAGCACTGATCCCTGATGAGCAAAAGCTA

Sequences in the Contig:

SY0AAA17YH17FM1 SY0AAA41YC19FM1 SY0AAA44YH17FM1
SY0AAA4YD20FM1 SY0AAB11YC21FM1 SY0AAB39YP19FM1
SY0AAB7YH17FM1 SY0AAC22YF02FM1 SY0AAC23YK15FM1
SY0AAC23YM06FM1 SY0AAC28YP20FM1 SY0AAC38YB09FM1