Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1411
Length(NT) : 1214
Best Gene Model Blast : Link to GSTUMT00009795001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein BC1G_00374
Accession: ref|XP_001561289.1| Score: 1073 E_value: 1e-115
KEGG Definition: hypothetical protein
Accession: ang:An07g08100 Score: 1011 E_value: 1e-108
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0519 Score: 349 E_value: 1e-33
PFAM Definition: Response_reg, Response regulator receiver domain. This domain receives the signal from the sensor partner in bacterial two-component systems. It is usually found N-terminal to a DNA binding effector domain..
Pfam Number: pfam00072 Score: 274 E_value: 6e-25
Swissprot: P48027|GACS_PSESY
Gene Ontology:
GO:0005886 = Cellular component: plasma membrane

Sequence:
>Contig1411
TTGGTGCACAGTCCGGCTCGCTACTACGGACCTCGCCTTGATTGTGCCAC
AACTCAAGCCTTACAGAGGACATCATGTTCTATTTATTGACAAAAACCGA
GAAAATGCCGATATCCCAGAAATGTTGAAAATGCTCGACTTAGTGCCTAT
TGTGGTTCACACAGCTGAGGAAGCACCCTTGCCAGATCCAATAACCAATG
GACGCAAGGGAGTTATGTACGATGTCATACTAGTCGATTCTATGGAGACT
GCCTTGAAACTGCGTACATTGGACGAGTTCAAGTACATACCATTAGTCCT
TCTATGCCCAATAATCAAGGTCTCCCTGAAATCCACTCTTGATCTGGGTA
TCACATCTTATATGACTACCCCATGCTTGCCAATCGATCTCGGTAATGGC
ATGATCCCAGCATTGGAAGGAAGGGCAGCCCCGTCGGTTTCCGAAAATTC
ACGATCATTCAACTTGCTCCTGGCAGAAGATAACATTGTCAACCAGAAAT
TAGCTGTCAAGATTCTCGAGAAGTATCATCATACGGTTCAGGTAGTGGAG
AATGGCCTCCAAGCCCTAGAAGCAGTCAAAAACAAGCGGTATGACGTTAT
TCTCATGGACGTTCAGATGCCGGTAATGGGTGGCTTCGAGGCCACCGCAA
AGATCCGAGAATATGAGAAGGATGCCGGGTTGCCACGGACACCTATTGTT
GCCTTAACGGCTCATGCTATGCTGGGTGACAGAGAAAAGTGCATCCAAGC
GCAGATGGATGAGTACCTATCGAAACCACTAAAGCAGAATACGCTCATTC
AGGTTATCCTCAAGTGTGCCACCCTTGGGGGGCCGCTTCTTGAAAGAGGG
ACTGGAATACTGTGTTCGATTCCCGACGATAGCGAGCGAGTCAGCAGAGT
TATTAATGGCGCGACAACGCAGCTAAGGCCCAGACCCATGCTTGAGCCGC
GGGCCGCAACAGCAAATGCGCCAATTCCAGGTGCAAGCACCTCAAGTGCG
CCCCTAGAACACGCAGATTCAGATACCACTGAGCGGTCTTTGTTCCGATC
CCTAAGCAGTTAGACGCGTGCCCCGAGGTGCAACCTCTTTTTTGCTCCTT
TTCATTTCTCAGTTTCTTGTTACTTTTGGAGTGGAGTTACATGCACGGGG
GAAAGGTTTGATGAAGTCCTGTTTGCATTTATCTTGCGAGCGAATGAGCC
TTTCCCGTCGCTGC

Sequences in the Contig:

SY0AAA4YD14FM1 SY0AAA53YC14FM1 SY0AAA58YL07FM1
SY0AAB25YP12FM1