Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1410
Length(NT) : 699
Best Gene Model Blast : Link to GSTUMT00010644001 E-value : 1e-150
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_11498
Accession: ref|XP_001550290.1| Score: 204 E_value: 2e-22
KEGG Definition: hypothetical protein
Accession: ncr:NCU05195.1 Score: 199 E_value: 1e-19
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: O94730|YG0I_SCHPO
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0043162 = Biological process: ubiquitin-dependent protein catabolic process via the multivesicular body pathway

Sequence:
>Contig1410
TTGGCACCCGAAAACTAACGAAACAGCAAAAATACCAAGATGTCAGAGCT
CCTCAGCTTTACCCTCGCCCACGAGCAATTTCGGAGAGCCCGCCTACCAT
CCCTATACTCCGACTTCTGCCCCCTCCGAGCAAACAACCCCTCCGGCTTT
CTCGCGAACGTCACAGCATGGAAGTCCGTTCTCAGCCAGGCCGCTGCGAA
TGGAATCCTAGGTGGCGACACGTTAGTTCTCGAGATCGGGGAGGGGCTAG
TTGGTTCCTTAGCGACGAGGGAGTGGGGGAGGCCGTTGGCGTTGGGGACC
GTTGTTGTATGTTTTTACCTTATTCACAGAGTAGCGTGATGGGTTAATGA
AAGTTTAGAATGAAGCAGTGTCTACGCGGGAGTTTATCTCGCTGGAGACG
TTTTTGGGTATGCGAGAGAGTGTGTATTATCGTCCTTGGGTGGATCCTTG
GAAGGTGCTTGTGTGGGGACTGGAAGTTGTGGGACTGAAAAGTCGGGCGG
TGGAGGATGGGAAGATTCGAGAGGGGAAGGTGGTGGTGCTTAAGAATATT
GAGGTATGGATTCTCCCCTTCTACCCACTGGCAGGGAGGTCACGATTCTA
ATACTGGTTTCACATAGGAGACGGCAAAAACAATCCTCAAAGAAATCTCC
AAGAGACCAATCATTGTCGATCGAATATTCTCCACAGAAATGTTCCTGC

Sequences in the Contig:

SY0AAA29YK19FM1 SY0AAA4YD08FM1