Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig141
Length(NT) : 1314
Best Gene Model Blast : Link to GSTUMT00000362001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 496 E_value: 5e-48
KEGG Definition: hypothetical protein
Accession: ang:An12g00850 Score: 467 E_value: 6e-45
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q00808|HETE1_PODAN

Sequence:
>Contig141
TTGGATCTTGACGAGTATCGAAGAACGCGCTCAACAACTGCGTAAACTCA
ACACATCCTCCTTCAATTTGAGAATCCTCCAACCAAATGGACGACCGACA
CTCGCGTAATGAGTTTGAGGGACTTCGCTCACCCCAGCGGTATGCACTTG
GAAGATCTGTTGCATATACCTCTACTGGCGCTCATGATTATTAATGGCAG
TAGTTATGGCTCTGGAAGTGCGGTCAATAGCTATAACCAGGGAAATTATA
TCGGTAACACTGGTTCTGGTAACAACTACAACTCGGGCAATACCAGCGTC
AATAATTATTACCAGCGCGCGGGCAATGATTTGTCCCAGAAAGACGCCGA
GATTTTGCAATGTCTATACACGTCTAAATACGAGCAACATCGGGATCGGG
TTCGGGTGCCCGTGGAGGGAACATGCACTTGGGTTACGGAGCACCCAAAG
TATAAGGACTGGTTGGGAAAGAAATCATCGGGTCTCCTCTGGCTATCGGG
GGACCCTGGATGCGGGAAATCGGTGGTCGCTTCGTTCCTCATAAACCATC
TAGGGATGCACACCGACGCCATCATTTGCTATTTCTTCTTCAAAGATGAC
AGCGAGGAACAGAAGAGTGCAGCATTTGCTCTCAGCGCTATACTACATCA
GCTCTTTGTGCAGCGAAACTCCCTCACCGTATTTGCCCAGGAAGCATTTA
AAGCCAAAGGAAAGGGGTTTACCGAAGAGGTCAACGCGTTGTGGGATATT
TTTGTTAGGGCGGTAACTGAGGGAGGGTGCGGCGAGGTGATTTGTGTGTT
GGATGCTTTGGACGAGTGTGGAGCAAGGACTCTGGATCAGCTTATTCGTT
GTATCGTCGGTCTCCCTCGATCGCAGACTCTCGGTATACCTTTGAAATTT
CTAGTTACCGGTCGCCCCTATCTCAAGATCGAGAGAGAGCTGGATTCATC
AGTAGCAACAATCCGGCTGAAGGGGGAGGCGGAGATTAGTGCTATTACTG
ATGATGTGAACCGGGTCATAGATGAAGGTATCAAGAGCTTAGAGTCATAT
TGGGAACGAGTGGGGAAGCTTGAATATTTGCGAAATCTTCTCAAATCTTC
GGCCGATCGGACATTCCTTTGGGTTTCTTTGGTTCTCGAGATTTTGAAGG
AAAGTCCCGATGACTCCGAGGAGGAGTTTACTAACATCGTATCTACCGCA
CCACATGATATAGCAGAATTGTACACCAAGATTTTGGACAGAAGCAGATA
TCCGGACAAAGCGCGAAAAATCCTCAACATTGTGGTAGCAGCTGCAAGGC
CTCTAACACTTGGA

Sequences in the Contig:

SY0AAA15YD07FM1 SY0AAA18YL06FM1 SY0AAA40YK14FM1
SY0AAA48YO13FM1 SY0AAB19YH08FM1 SY0AAB59YD17FM1