Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1409
Length(NT) : 862
Best Gene Model Blast : Link to GSTUMT00011434001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein SS1G_06734
Accession: ref|XP_001592493.1| Score: 454 E_value: 2e-43
KEGG Definition: predicted protein [EC:4.6.1.13]; K01771 1-phosphatidylinositol phosphodiesterase
Accession: aor:AO090003001009 Score: 421 E_value: 7e-40
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG4306 Score: 112 E_value: 2e-06
PFAM Definition: PI-PLC-X, Phosphatidylinositol-specific phospholipase C, X domain. This associates with pfam00387 to form a single structural unit..
Pfam Number: pfam00388 Score: 120 E_value: 3e-07
Swissprot: P14262|PLC_BACCE
Gene Ontology:
GO:0004436 = Molecular function: phosphatidylinositol diacylglycerol-lyase activity

Sequence:
>Contig1409
TTGGGGTACACCACTTATCTTGTCATAATAACTCAACCACCGTAATGGCG
CACGAAAACCTCACAATCCGTAACCTCTCCTCGACAGAAATATCTGTAAC
CCGTGTGTCGCGCTTCCCGGATCCAGGGCCCCAGCCGGTGACGATAAAGA
ACATAACCAACATCAAAAACCTAGCCCACAACTTCACATCTTTTGTCGCA
AAGGCCATACCACCGCCGGGCGAACCGTCTTCCCAGACAATCGCGGAGAA
CGCGCAAGCCTTCTCTGAGGAGGATGCATCAATACGCCTACCGGCGTTTG
CAATCGTGCAGACAGATATCAAGATCAACAAAGACCAAGTCGTGCGATTG
GCCTTCACGGTCGGCGAGGCTAGATTCCGCGTGGACCTAAGTTCGCACAC
GCCGGCTGTACACTGTCTGAGTCCTGGAACGGAGCATAAGTTCAATGCGG
TGTTTCACCGGAACCACAGCCATCTCGCGCTCCTATCCAGCGCCGCGCTG
GGCGGGTGGATGGAGCGTTTGAAGGACGAGACCCCGCTGAGCCTGATCTC
CATCCCGGGCACGCACAATACCCCAACGTGCTACCCCGCGCTCCCAACCG
TTCGCTGCCAGGCCGTTGGCCCGAAGCAGCAATTGGAAAATGGAATCCGC
TTCTTCGACATTAGGTGTCATGTCGACCGCGCAAACGCCCTAACCCTCGT
GCACGGGGCCTTCCCAATCTCTCTGGTAGGATGCAAAGGCCTGAGCGAGG
TTCTCAAAGATGCGTACTCATTCTTGGATGGCAATCCGCACGAGTGCATC
ATCGTCTCACTAAAGAGGGAAGGCCGCGGCGACGCCGACGACGCCAAGTT
TGCGAAGGCCAA

Sequences in the Contig:

SY0AAA19YB03FM1 SY0AAA49YE13FM1 SY0AAA4YB22FM1
SY0AAB53YA15FM1