Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1408
Length(NT) : 976
Best Gene Model Blast : Link to GSTUMT00008696001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_12886
Accession: ref|XP_001586308.1| Score: 1348 E_value: 1e-147
KEGG Definition: GLUCOSE-6-PHOSPHATE 1-DEHYDROGENASE (G6PD)
Accession: ncr:NCU09111.1 Score: 1322 E_value: 1e-144
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG0563 Score: 1005 E_value: 1e-110
PFAM Definition: G6PD_C, Glucose-6-phosphate dehydrogenase, C-terminal domain..
Pfam Number: pfam02781 Score: 1075 E_value: 1e-118
Swissprot: P48826|G6PD_ASPNG

Sequence:
>Contig1408
TTGGGAAGGACGTGGGGGTTACTTCGATGATTTTGGGATCATTCGCGATG
TTATGCAGAATCATCTTCTCCAGGTATTGACTATTATTGGGATGGAACGT
CCAATTTCGTTTTCCGCTGAAGATATCCGCGATGAGAAGGTCAGAGTTCT
TCGAGGAATTCCAGCTATTGAGCCCAAGAATGTCATCATTGGCCAATACG
GGAAATCGCTTGATGGCAGCAAGCCTGGGTATCTGGATGACGACACTGTC
CCTAAGGATAGCAGATGTCCAACATTCTGTGCTTTGGCTGTCTATATCAA
GAACGAGAGATGGGACGGTGTTCCATTCATCCTGAAGGCTGGAAAAGCCC
TGAACGAGCAGAAGACCGAAATAAGAATCCAGTTTAAGGACGTCACCAGC
GGTATCTTCAAGGACATCCCCCGCAATGAGCTTGTCATTCGTGTCCAGCC
CAACGAGAGTGTCTATATTAAGATGAACTCGAAGCTGCCTGGATTAAGTA
TGCAAACTGCTGTCACTGAACTTGATCTTACCTATAGACGCCGTTTCAGT
GATCTCAAAATCCCAGAGGCATACGAGGCACTTATTCTCGACGCTTTGAA
GGGCGACCATTCTAACTTTGTCCGCGATGATGAATTGGACGCAAGCTGGA
GAATTTTCACCCCTCTCTTGCATTACCTCGACGAGAACAAAGAGATTATT
CCAATGGAATACCCATACGGTTCACGTGGGCCGGCAGTTTTGGATGACTT
CACCGCGTCTTACGGATATAAGTTTAACGATCTTGGAGGATATCAGTGGC
CTGTACAGAGCACTGCTCCTCACAAGCTCTAGCCAGGGTTTTTCCTTTTC
CAATGTGATGGCTTTAAAACCTTCCGCAAAAATGCCAGGAACCTTTTACC
ACATCCTGACCATGAATCTCGTGGCATGAGTGTTATTTCTCTTTTTGGAT
CACAGCGACTTGACCGAACCACTAGT

Sequences in the Contig:

SY0AAA4YA07FM1 SY0AAB20YD15FM1