Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1407
Length(NT) : 703
Best Gene Model Blast : Link to GSTUMT00011745001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein AN1338.2
Accession: ref|XP_658942.1| Score: 166 E_value: 4e-10
KEGG Definition: hypothetical protein
Accession: ani:AN1338.2 Score: 166 E_value: 2e-10
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1407
TTGGGGTTTTTTTGCGAGTCCCTCGTTGTCGTTCGCTGATACCCTCTCCC
TCCTGGTACACTATTTATTTGTGTGCACGCTCGCTCTCGTCTATAATTTT
TATACCAATATTTGCTACCCCTTAATACTTGTACTTCTTTAATCGATACC
CACAATGCTATTCGAAATTCCCTCCACTATTGTCTTCGCTCTCGCCCTTG
CCGGCTTCACTTCTGCTCAGACCTGGCAAGTCGACCACAGCTGTGATGCT
TTCAACGTTGTTGAGACTTGTATTTCCCAGTACAGCCCGCGCGTTTCTGG
TTGCTCTCAAAATGATTACTCGTGTTTGTGTGTTGAGTACACGAACCTTT
TGACCTGTTATAACAATTGCCCAAAGGATACCAACTCGTCTGGTATTAAG
AGCAGTGTTACCTCCTTCTGTAATGCAGCGGCGGCAGCTTCTTCAGCGTC
TGCTTTGACAAACACAGCCAAGTCAACTTCCGGTACGGGTAGTTCCACTG
CAGCCTCTTCAGCGCCCACTGGTTCTGGATCTCCGACTACCACTAAAGCT
CCGTCTTCCTCCAGCTCGTCATCCTCTGGTTCTGGCTCCTCCAATGCCGC
GCTTGCCCTTACACCTGTTGGTACTTACGGCGCTTTGGCTGGTGTCATGG
CAATTGCTGGTATCTTCTTGTAGATTCTGTGAGTTGGAGTTGAGCGGTAG
TGT

Sequences in the Contig:

SY0AAA21YD24FM1 SY0AAA39YH19FM1 SY0AAA4YA03FM1
SY0AAB10YH01FM1 SY0AAB11YO15FM1 SY0AAB34YF23FM1
SY0AAB35YE21FM1