Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1406
Length(NT) : 974
Best Gene Model Blast : Link to GSTUMT00004037001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001212085.1| Score: 304 E_value: 6e-26
KEGG Definition: hypothetical protein
Accession: ani:AN5753.2 Score: 297 E_value: 2e-25
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1406
TTGGGTTGCCTGATCTCGCCTTTTACAATACTCGGGGTTTTGGTGTTGAG
AGAGCGAAAGAAATAGATAACGGTGACGATCAATAATTGGCAGTGACACC
ACTTCCGTTGGTGCATTAGGTCGAGAAAACATATGCAACCGGGAACGCCC
GAAGCGATATCAACCACAATCTACTCGTACGCTACTGCCATCCACCACCA
GTCACAAGAGTCTTCCCCACAAAATTGATTCCCGAAGAGCCTATCCTCAC
AAGCCAACAGCTGGAGGAAATAAATAATAGCCATCCATCATCCCGAAATA
TCGCGACACACCACCCCTCGTCATCACCCGGGCCATTCGCCATCCTCCTG
CTCCTCAGCACTTTGATAAGAACCACTTCTCCTCTCTCTCCCCCCGTCGA
GCCGCTCGTTCGCAAAGGCATAGTACCGAAAGCAAAACATCACAATGAGC
GCATCTCAAGCCCTCCGTGCCTCAACCGCCGGACGCACCCCCCTTATCCA
GTTTCTGGGGAAGCGCTCAATCCCTGAATCCATCGATCACACTCCGCGTC
CTCACCCCGCGGCAACCAAGGCGCTACCAAACTCGTTCGCCGAATACCGC
AAGAAGGCACAACAGCACGGGCCCCTGGGCGGTTACAAGGCAGCGACGGC
AACCAGCATTTCGCCCGGCAAGGGTCAGGTTTTCGACAGGAGCGAACTGC
CCCCACGATTCTGGCGCCTGACGTTGAGCAAGGAGGAAATGGAGGTCATC
GAGAGCGGCGGGGCCGCGATGGCATAATCAATTAATATGCCCCTTTCTTA
TTCCCTGATACGACGACACAACAAACATTCATAATTTACCTCGGTTTCTT
TTTTTTCCTTTCTTTTTTTTTTTCCTTTTCCTTGTTCACCGGAAGAGCGA
GAGGCGATTGTATGATATCACAATGGGCGTGGGCTGGTGGATGAATCGAG
CGAGTATGTGGGTAGTGGGGTACA

Sequences in the Contig:

SY0AAA36YL16FM1 SY0AAA45YG08FM1 SY0AAA49YP21FM1
SY0AAB20YL14FM1 SY0AAB26YK16FM1 SY0AAC42YH08FM1
SY0AAC45YD10FM1 SY0AAD13YJ06FM1 SY0AAD35YL05FM1